Incidental Mutation 'R9644:Plxnd1'
ID 726138
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Name plexin D1
Synonyms b2b553Clo, 6230425C21Rik, b2b1863Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9644 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 115954811-115995005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 115963313 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 1370 (R1370Q)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
AlphaFold Q3UH93
Predicted Effect possibly damaging
Transcript: ENSMUST00000015511
AA Change: R1370Q

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: R1370Q

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131590
SMART Domains Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

DomainStartEndE-ValueType
Blast:PSI 2 34 1e-13 BLAST
IPT 35 124 4.43e-20 SMART
Blast:IPT 125 177 3e-30 BLAST
Pfam:TIG 180 233 4.6e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,186,295 S32* probably null Het
Adam34 T A 8: 43,651,729 H293L probably damaging Het
Adgrl3 A G 5: 81,724,189 N910S probably damaging Het
Ankrd11 C T 8: 122,890,943 A2057T probably benign Het
Ankrd36 A G 11: 5,643,835 D480G possibly damaging Het
Aox4 T A 1: 58,228,119 D185E probably benign Het
Apol8 C A 15: 77,749,495 V294L probably damaging Het
Arsk G A 13: 76,072,108 A289V probably damaging Het
Atg101 A G 15: 101,290,566 D184G probably benign Het
Atp10b C T 11: 43,151,832 T73I probably damaging Het
Ccser2 A T 14: 36,879,193 N411K possibly damaging Het
Cct5 A G 15: 31,601,699 S3P probably benign Het
Chn1 A T 2: 73,659,840 I31K probably benign Het
Clec2e T A 6: 129,093,480 I193L probably benign Het
Crim1 G A 17: 78,280,068 G201R probably damaging Het
Ctrc A G 4: 141,845,025 V68A probably damaging Het
Dennd4c T A 4: 86,795,126 I438N probably damaging Het
Dnah5 T A 15: 28,230,504 W183R probably damaging Het
Dnali1 T A 4: 125,056,609 I253F probably damaging Het
Dyrk1b T C 7: 28,182,365 L83P probably damaging Het
Emx2 T C 19: 59,463,995 I237T probably benign Het
Enpp3 C T 10: 24,809,903 R198K probably damaging Het
Epb41l1 C T 2: 156,525,245 P678L possibly damaging Het
Epm2aip1 C T 9: 111,273,069 T370I probably damaging Het
Fam184a T G 10: 53,697,246 Q346P probably damaging Het
Foxi2 A C 7: 135,411,998 H319P possibly damaging Het
Gatad1 A G 5: 3,641,442 V250A possibly damaging Het
Gmeb1 T C 4: 132,232,129 I205V probably benign Het
Gucy2g C G 19: 55,231,105 V362L probably benign Het
Hace1 T C 10: 45,649,905 S281P probably benign Het
Helz C A 11: 107,672,861 A1709D unknown Het
Igf2bp2 T A 16: 22,083,985 N115Y probably damaging Het
Igkv4-86 C T 6: 68,910,609 V49I probably benign Het
Kdm2b A T 5: 122,982,779 V101E probably damaging Het
Kidins220 A G 12: 25,011,019 D790G probably damaging Het
Kif18a A G 2: 109,341,172 T865A probably benign Het
Kif1b A G 4: 149,291,379 V10A probably damaging Het
Kmt2d A T 15: 98,845,504 M3925K unknown Het
Mcee G T 7: 64,411,982 A178S possibly damaging Het
Megf10 A T 18: 57,242,701 H233L probably benign Het
Meox1 T A 11: 101,878,656 E238V probably benign Het
Myo5a G A 9: 75,136,349 G207R probably damaging Het
Nemf T A 12: 69,312,662 N966I possibly damaging Het
Olfr1419 T C 19: 11,871,210 E2G probably benign Het
Olfr1487 G T 19: 13,619,980 A230S probably benign Het
Olfr342 A T 2: 36,527,765 M118L probably damaging Het
Olfr773 A G 10: 129,186,869 I184T possibly damaging Het
Pfas T C 11: 68,992,716 Q662R probably benign Het
Phf2 G T 13: 48,870,742 C8* probably null Het
Pkhd1 T A 1: 20,547,466 N965I probably benign Het
Prdm8 A T 5: 98,185,779 T402S probably benign Het
Proz T A 8: 13,066,854 D135E probably benign Het
Prpmp5 T A 6: 132,312,255 Q202L unknown Het
Prtg T A 9: 72,906,211 I951K probably damaging Het
Rasgef1b A T 5: 99,232,155 Y288* probably null Het
Sacs T A 14: 61,205,979 C1825S probably benign Het
Slc22a12 G C 19: 6,537,643 P427R probably damaging Het
Slfn3 A G 11: 83,214,902 Y575C probably damaging Het
St18 C T 1: 6,859,052 T56I Het
Synrg T C 11: 84,019,870 L876S probably damaging Het
Tchh T C 3: 93,447,359 C1369R unknown Het
Tet2 G A 3: 133,487,303 Q457* probably null Het
Thap12 T C 7: 98,715,288 V221A probably damaging Het
Tor3a T A 1: 156,673,556 D104V probably damaging Het
Trpc2 T C 7: 102,095,232 V737A possibly damaging Het
Trpc4 A G 3: 54,222,278 Y155C probably damaging Het
Tspyl1 T C 10: 34,283,139 S287P possibly damaging Het
Ube2u TAGAAGAAGAAGAAGAAGAAGAAGAAGA TAGAAGAAGAAGAAGAAGAAGAAGA 4: 100,549,746 probably benign Het
Ubr2 A G 17: 46,955,780 probably null Het
Vmn1r238 T A 18: 3,122,635 T260S probably benign Het
Wisp1 T G 15: 66,912,936 C153G Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
Hiss UTSW 6 115969929 missense possibly damaging 0.94
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
rattle UTSW 6 115959794 missense probably damaging 0.96
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
R8539:Plxnd1 UTSW 6 115962807 missense possibly damaging 0.94
R8548:Plxnd1 UTSW 6 115957597 missense probably damaging 1.00
R8963:Plxnd1 UTSW 6 115972545 nonsense probably null
R9119:Plxnd1 UTSW 6 115955871 splice site probably benign
R9177:Plxnd1 UTSW 6 115966508 missense probably benign 0.00
R9182:Plxnd1 UTSW 6 115993785 missense probably damaging 0.98
R9185:Plxnd1 UTSW 6 115957565 missense probably damaging 1.00
R9226:Plxnd1 UTSW 6 115957563 missense probably damaging 1.00
R9433:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R9449:Plxnd1 UTSW 6 115955769 missense probably damaging 1.00
R9451:Plxnd1 UTSW 6 115963316 missense possibly damaging 0.72
R9599:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9627:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9672:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACGGCTGAGTGAATGCCTC -3'
(R):5'- GCTTTTCTCAACCTCAGAACAC -3'

Sequencing Primer
(F):5'- CTGAGTGAATGCCTCCTAGAAG -3'
(R):5'- GAACACAGCAGCTTGCCTG -3'
Posted On 2022-09-12