Incidental Mutation 'R0765:Med23'
ID72614
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission 038945-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0765 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24900710 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 347 (S347P)
Ref Sequence ENSEMBL: ENSMUSP00000135232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]
Predicted Effect probably damaging
Transcript: ENSMUST00000020159
AA Change: S707P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: S707P

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092646
AA Change: S713P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: S713P

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176285
AA Change: S347P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: S347P

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176827
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Meta Mutation Damage Score 0.0928 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T A 5: 107,506,934 D354E probably benign Het
Abhd16a T A 17: 35,101,851 V425D probably benign Het
Ano9 T G 7: 141,107,184 I381L probably damaging Het
Apob C T 12: 8,016,518 L4496F probably benign Het
Arhgef38 C T 3: 133,116,583 E724K probably damaging Het
Atp8b4 T A 2: 126,372,150 probably null Het
Baiap2l1 G T 5: 144,277,703 P394T probably damaging Het
Cnbp C A 6: 87,845,173 C122F probably damaging Het
Col3a1 A G 1: 45,336,651 probably benign Het
Colq T G 14: 31,526,037 D408A possibly damaging Het
Cuzd1 A T 7: 131,316,095 S259T probably benign Het
Cyp3a57 A G 5: 145,390,410 probably benign Het
Dbn1 C A 13: 55,482,294 V112F probably damaging Het
Dcc T A 18: 71,362,990 D1028V probably damaging Het
Dnajb11 T C 16: 22,862,568 V32A probably damaging Het
Dsg4 G A 18: 20,454,646 probably benign Het
Dyrk1b C T 7: 28,185,711 probably benign Het
Ebf1 T A 11: 44,869,160 M208K probably damaging Het
Efhc1 A G 1: 20,978,652 I430V probably benign Het
Elovl2 T C 13: 41,187,466 Y181C probably benign Het
Fras1 A G 5: 96,552,796 Q225R probably benign Het
Frmd3 G A 4: 74,161,767 R332Q probably damaging Het
Glg1 A G 8: 111,159,797 probably null Het
Hmcn1 G A 1: 150,808,787 T344M probably damaging Het
Il1rap T G 16: 26,710,632 probably null Het
Klra1 A T 6: 130,379,092 probably benign Het
Larp7 C A 3: 127,546,165 K289N probably damaging Het
Lgr6 C A 1: 134,993,886 G240V probably benign Het
Lrp10 G T 14: 54,468,090 D246Y probably damaging Het
Map3k20 G A 2: 72,371,925 V167I probably damaging Het
Mybph T C 1: 134,197,496 V254A possibly damaging Het
Ndufv2 A G 17: 66,101,078 probably benign Het
Nuf2 A T 1: 169,522,936 probably benign Het
Nup210l T C 3: 90,119,877 Y189H probably damaging Het
Olfr1025-ps1 T C 2: 85,918,705 L260P probably damaging Het
Olfr1263 G A 2: 90,015,670 V247I probably benign Het
Olfr574 C T 7: 102,948,732 T79I probably damaging Het
Pdgfra C A 5: 75,187,987 probably benign Het
Phlpp1 T C 1: 106,392,283 L1336P probably damaging Het
Prpf38b T C 3: 108,911,418 T9A possibly damaging Het
Rnf213 G A 11: 119,423,095 probably null Het
Saal1 A T 7: 46,699,647 V281E possibly damaging Het
Slc17a3 C T 13: 23,846,896 Q186* probably null Het
Slc6a2 A G 8: 92,989,031 T266A probably damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
Srfbp1 T C 18: 52,490,435 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tesk1 C T 4: 43,446,706 P365S possibly damaging Het
Tmem127 C A 2: 127,257,149 T201K probably damaging Het
Trim17 T G 11: 58,971,369 V409G possibly damaging Het
Trim43c C T 9: 88,841,916 T165I probably benign Het
Ush2a C A 1: 188,948,574 F4916L possibly damaging Het
Vmn1r89 A G 7: 13,219,540 M68V probably benign Het
Vmn2r105 C T 17: 20,227,711 E284K probably benign Het
Vmn2r105 T C 17: 20,227,857 D235G probably damaging Het
Vmn2r-ps134 C T 17: 23,446,041 noncoding transcript Het
Zdbf2 G A 1: 63,305,723 S1087N possibly damaging Het
Zfp534 G A 4: 147,674,236 P659S probably damaging Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
R8874:Med23 UTSW 10 24895719 missense possibly damaging 0.92
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACCAGTTCCAGCTACGGCG -3'
(R):5'- GCTATTACCAGGTCAAGCACTCCC -3'

Sequencing Primer
(F):5'- ATTCCCTTGGCCCAGGAAAG -3'
(R):5'- GGTCAAGCACTCCCTAGAAAG -3'
Posted On2013-09-30