Incidental Mutation 'R9644:Enpp3'
ID 726152
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms CD203c
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R9644 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 24649712-24712093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24685801 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Lysine at position 198 (R198K)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000219342]
AlphaFold Q6DYE8
Predicted Effect probably damaging
Transcript: ENSMUST00000020169
AA Change: R198K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: R198K

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217903
Predicted Effect probably damaging
Transcript: ENSMUST00000219342
AA Change: R33K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,270,752 (GRCm39) S32* probably null Het
Adam34 T A 8: 44,104,766 (GRCm39) H293L probably damaging Het
Adgrl3 A G 5: 81,872,036 (GRCm39) N910S probably damaging Het
Ankrd11 C T 8: 123,617,682 (GRCm39) A2057T probably benign Het
Ankrd36 A G 11: 5,593,835 (GRCm39) D480G possibly damaging Het
Aox4 T A 1: 58,267,278 (GRCm39) D185E probably benign Het
Apol8 C A 15: 77,633,695 (GRCm39) V294L probably damaging Het
Arsk G A 13: 76,220,227 (GRCm39) A289V probably damaging Het
Atg101 A G 15: 101,188,447 (GRCm39) D184G probably benign Het
Atp10b C T 11: 43,042,659 (GRCm39) T73I probably damaging Het
Ccn4 T G 15: 66,784,785 (GRCm39) C153G Het
Ccser2 A T 14: 36,601,150 (GRCm39) N411K possibly damaging Het
Cct5 A G 15: 31,601,845 (GRCm39) S3P probably benign Het
Chn1 A T 2: 73,490,184 (GRCm39) I31K probably benign Het
Clec2e T A 6: 129,070,443 (GRCm39) I193L probably benign Het
Crim1 G A 17: 78,587,497 (GRCm39) G201R probably damaging Het
Ctrc A G 4: 141,572,336 (GRCm39) V68A probably damaging Het
Dennd4c T A 4: 86,713,363 (GRCm39) I438N probably damaging Het
Dnah5 T A 15: 28,230,650 (GRCm39) W183R probably damaging Het
Dnali1 T A 4: 124,950,402 (GRCm39) I253F probably damaging Het
Dyrk1b T C 7: 27,881,790 (GRCm39) L83P probably damaging Het
Emx2 T C 19: 59,452,427 (GRCm39) I237T probably benign Het
Epb41l1 C T 2: 156,367,165 (GRCm39) P678L possibly damaging Het
Epm2aip1 C T 9: 111,102,137 (GRCm39) T370I probably damaging Het
Fam184a T G 10: 53,573,342 (GRCm39) Q346P probably damaging Het
Foxi2 A C 7: 135,013,727 (GRCm39) H319P possibly damaging Het
Gatad1 A G 5: 3,691,442 (GRCm39) V250A possibly damaging Het
Gmeb1 T C 4: 131,959,440 (GRCm39) I205V probably benign Het
Gucy2g C G 19: 55,219,537 (GRCm39) V362L probably benign Het
Hace1 T C 10: 45,526,001 (GRCm39) S281P probably benign Het
Helz C A 11: 107,563,687 (GRCm39) A1709D unknown Het
Igf2bp2 T A 16: 21,902,735 (GRCm39) N115Y probably damaging Het
Igkv4-86 C T 6: 68,887,593 (GRCm39) V49I probably benign Het
Kdm2b A T 5: 123,120,842 (GRCm39) V101E probably damaging Het
Kidins220 A G 12: 25,061,018 (GRCm39) D790G probably damaging Het
Kif18a A G 2: 109,171,517 (GRCm39) T865A probably benign Het
Kif1b A G 4: 149,375,836 (GRCm39) V10A probably damaging Het
Kmt2d A T 15: 98,743,385 (GRCm39) M3925K unknown Het
Mcee G T 7: 64,061,730 (GRCm39) A178S possibly damaging Het
Megf10 A T 18: 57,375,773 (GRCm39) H233L probably benign Het
Meox1 T A 11: 101,769,482 (GRCm39) E238V probably benign Het
Myo5a G A 9: 75,043,631 (GRCm39) G207R probably damaging Het
Nemf T A 12: 69,359,436 (GRCm39) N966I possibly damaging Het
Or10q3 T C 19: 11,848,574 (GRCm39) E2G probably benign Het
Or1j14 A T 2: 36,417,777 (GRCm39) M118L probably damaging Het
Or5b123 G T 19: 13,597,344 (GRCm39) A230S probably benign Het
Or6c204 A G 10: 129,022,738 (GRCm39) I184T possibly damaging Het
Pfas T C 11: 68,883,542 (GRCm39) Q662R probably benign Het
Phf2 G T 13: 49,024,218 (GRCm39) C8* probably null Het
Pkhd1 T A 1: 20,617,690 (GRCm39) N965I probably benign Het
Plxnd1 C T 6: 115,940,274 (GRCm39) R1370Q possibly damaging Het
Prb1b T A 6: 132,289,218 (GRCm39) Q202L unknown Het
Prdm8 A T 5: 98,333,638 (GRCm39) T402S probably benign Het
Proz T A 8: 13,116,854 (GRCm39) D135E probably benign Het
Prtg T A 9: 72,813,493 (GRCm39) I951K probably damaging Het
Rasgef1b A T 5: 99,380,014 (GRCm39) Y288* probably null Het
Sacs T A 14: 61,443,428 (GRCm39) C1825S probably benign Het
Slc22a12 G C 19: 6,587,673 (GRCm39) P427R probably damaging Het
Slfn3 A G 11: 83,105,728 (GRCm39) Y575C probably damaging Het
St18 C T 1: 6,929,276 (GRCm39) T56I Het
Synrg T C 11: 83,910,696 (GRCm39) L876S probably damaging Het
Tchh T C 3: 93,354,666 (GRCm39) C1369R unknown Het
Tet2 G A 3: 133,193,064 (GRCm39) Q457* probably null Het
Thap12 T C 7: 98,364,495 (GRCm39) V221A probably damaging Het
Tor3a T A 1: 156,501,126 (GRCm39) D104V probably damaging Het
Trpc2 T C 7: 101,744,439 (GRCm39) V737A possibly damaging Het
Trpc4 A G 3: 54,129,699 (GRCm39) Y155C probably damaging Het
Tspyl1 T C 10: 34,159,135 (GRCm39) S287P possibly damaging Het
Ube2u TAGAAGAAGAAGAAGAAGAAGAAGAAGA TAGAAGAAGAAGAAGAAGAAGAAGA 4: 100,406,943 (GRCm39) probably benign Het
Ubr2 A G 17: 47,266,706 (GRCm39) probably null Het
Vmn1r238 T A 18: 3,122,635 (GRCm39) T260S probably benign Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24,663,670 (GRCm39) missense probably benign 0.00
IGL00778:Enpp3 APN 10 24,674,160 (GRCm39) missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24,650,805 (GRCm39) missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24,681,820 (GRCm39) nonsense probably null
IGL01642:Enpp3 APN 10 24,674,167 (GRCm39) missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24,667,923 (GRCm39) missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24,652,692 (GRCm39) missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24,649,900 (GRCm39) missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24,667,881 (GRCm39) splice site probably benign
IGL02517:Enpp3 APN 10 24,685,746 (GRCm39) splice site probably benign
IGL02956:Enpp3 APN 10 24,650,841 (GRCm39) splice site probably benign
R0017:Enpp3 UTSW 10 24,675,051 (GRCm39) splice site probably null
R0042:Enpp3 UTSW 10 24,650,722 (GRCm39) missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24,652,767 (GRCm39) missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24,680,334 (GRCm39) missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24,696,495 (GRCm39) missense probably benign 0.00
R0450:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24,671,614 (GRCm39) missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24,660,851 (GRCm39) splice site probably benign
R1261:Enpp3 UTSW 10 24,650,832 (GRCm39) missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24,671,680 (GRCm39) missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24,654,687 (GRCm39) missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24,652,669 (GRCm39) nonsense probably null
R1966:Enpp3 UTSW 10 24,683,389 (GRCm39) missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24,652,776 (GRCm39) missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24,681,793 (GRCm39) missense probably benign 0.00
R2380:Enpp3 UTSW 10 24,652,770 (GRCm39) missense probably benign
R2410:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R3794:Enpp3 UTSW 10 24,707,630 (GRCm39) splice site probably null
R3896:Enpp3 UTSW 10 24,653,847 (GRCm39) missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24,669,487 (GRCm39) missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24,652,780 (GRCm39) missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24,649,825 (GRCm39) missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24,674,175 (GRCm39) missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24,683,436 (GRCm39) missense probably benign 0.01
R5045:Enpp3 UTSW 10 24,652,665 (GRCm39) missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24,685,814 (GRCm39) missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24,684,058 (GRCm39) missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24,654,719 (GRCm39) missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24,650,740 (GRCm39) missense probably benign 0.37
R6117:Enpp3 UTSW 10 24,663,750 (GRCm39) missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24,684,089 (GRCm39) missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24,653,855 (GRCm39) missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24,683,351 (GRCm39) missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24,685,768 (GRCm39) missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24,684,064 (GRCm39) missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24,702,093 (GRCm39) missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24,649,945 (GRCm39) missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24,652,782 (GRCm39) missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24,693,742 (GRCm39) missense unknown
R7487:Enpp3 UTSW 10 24,681,821 (GRCm39) missense probably benign 0.02
R7529:Enpp3 UTSW 10 24,674,072 (GRCm39) missense probably damaging 0.97
R7583:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R7692:Enpp3 UTSW 10 24,660,739 (GRCm39) nonsense probably null
R7962:Enpp3 UTSW 10 24,660,752 (GRCm39) missense probably damaging 1.00
R7965:Enpp3 UTSW 10 24,654,717 (GRCm39) missense possibly damaging 0.90
R8153:Enpp3 UTSW 10 24,685,777 (GRCm39) missense probably damaging 1.00
R8262:Enpp3 UTSW 10 24,653,824 (GRCm39) missense probably damaging 1.00
R8305:Enpp3 UTSW 10 24,700,827 (GRCm39) critical splice acceptor site probably null
R8393:Enpp3 UTSW 10 24,702,139 (GRCm39) missense probably damaging 1.00
R8776:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8962:Enpp3 UTSW 10 24,696,513 (GRCm39) missense probably benign 0.12
R9047:Enpp3 UTSW 10 24,674,172 (GRCm39) missense possibly damaging 0.83
R9093:Enpp3 UTSW 10 24,671,702 (GRCm39) missense probably benign 0.00
R9117:Enpp3 UTSW 10 24,702,078 (GRCm39) missense possibly damaging 0.67
R9194:Enpp3 UTSW 10 24,675,092 (GRCm39) missense possibly damaging 0.90
R9224:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R9244:Enpp3 UTSW 10 24,654,689 (GRCm39) missense probably damaging 1.00
R9387:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R9658:Enpp3 UTSW 10 24,649,802 (GRCm39) makesense probably null
X0026:Enpp3 UTSW 10 24,702,140 (GRCm39) missense probably damaging 1.00
Z1176:Enpp3 UTSW 10 24,663,691 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGCCTGGATTCAGTGGTGC -3'
(R):5'- AACATCGATGCCTCCTGACTC -3'

Sequencing Primer
(F):5'- GATTCAGTGGTGCACTTATGAAG -3'
(R):5'- GCCCATTTGACTCCCAGAAATGG -3'
Posted On 2022-09-12