Incidental Mutation 'R9644:Atp10b'
ID 726158
Institutional Source Beutler Lab
Gene Symbol Atp10b
Ensembl Gene ENSMUSG00000055415
Gene Name ATPase, class V, type 10B
Synonyms 9030605H24Rik, 5930426O13Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R9644 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 43040704-43153112 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43042659 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 73 (T73I)
Ref Sequence ENSEMBL: ENSMUSP00000076844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077659]
AlphaFold B1AWN4
Predicted Effect probably damaging
Transcript: ENSMUST00000077659
AA Change: T73I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076844
Gene: ENSMUSG00000055415
AA Change: T73I

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 47 118 3.8e-26 PFAM
Pfam:E1-E2_ATPase 123 393 2.9e-7 PFAM
low complexity region 621 638 N/A INTRINSIC
Pfam:Cation_ATPase 692 799 7.1e-9 PFAM
Pfam:HAD 705 1062 6.7e-12 PFAM
Pfam:PhoLip_ATPase_C 1079 1324 1.9e-79 PFAM
low complexity region 1353 1366 N/A INTRINSIC
low complexity region 1457 1471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,270,752 (GRCm39) S32* probably null Het
Adam34 T A 8: 44,104,766 (GRCm39) H293L probably damaging Het
Adgrl3 A G 5: 81,872,036 (GRCm39) N910S probably damaging Het
Ankrd11 C T 8: 123,617,682 (GRCm39) A2057T probably benign Het
Ankrd36 A G 11: 5,593,835 (GRCm39) D480G possibly damaging Het
Aox4 T A 1: 58,267,278 (GRCm39) D185E probably benign Het
Apol8 C A 15: 77,633,695 (GRCm39) V294L probably damaging Het
Arsk G A 13: 76,220,227 (GRCm39) A289V probably damaging Het
Atg101 A G 15: 101,188,447 (GRCm39) D184G probably benign Het
Ccn4 T G 15: 66,784,785 (GRCm39) C153G Het
Ccser2 A T 14: 36,601,150 (GRCm39) N411K possibly damaging Het
Cct5 A G 15: 31,601,845 (GRCm39) S3P probably benign Het
Chn1 A T 2: 73,490,184 (GRCm39) I31K probably benign Het
Clec2e T A 6: 129,070,443 (GRCm39) I193L probably benign Het
Crim1 G A 17: 78,587,497 (GRCm39) G201R probably damaging Het
Ctrc A G 4: 141,572,336 (GRCm39) V68A probably damaging Het
Dennd4c T A 4: 86,713,363 (GRCm39) I438N probably damaging Het
Dnah5 T A 15: 28,230,650 (GRCm39) W183R probably damaging Het
Dnali1 T A 4: 124,950,402 (GRCm39) I253F probably damaging Het
Dyrk1b T C 7: 27,881,790 (GRCm39) L83P probably damaging Het
Emx2 T C 19: 59,452,427 (GRCm39) I237T probably benign Het
Enpp3 C T 10: 24,685,801 (GRCm39) R198K probably damaging Het
Epb41l1 C T 2: 156,367,165 (GRCm39) P678L possibly damaging Het
Epm2aip1 C T 9: 111,102,137 (GRCm39) T370I probably damaging Het
Fam184a T G 10: 53,573,342 (GRCm39) Q346P probably damaging Het
Foxi2 A C 7: 135,013,727 (GRCm39) H319P possibly damaging Het
Gatad1 A G 5: 3,691,442 (GRCm39) V250A possibly damaging Het
Gmeb1 T C 4: 131,959,440 (GRCm39) I205V probably benign Het
Gucy2g C G 19: 55,219,537 (GRCm39) V362L probably benign Het
Hace1 T C 10: 45,526,001 (GRCm39) S281P probably benign Het
Helz C A 11: 107,563,687 (GRCm39) A1709D unknown Het
Igf2bp2 T A 16: 21,902,735 (GRCm39) N115Y probably damaging Het
Igkv4-86 C T 6: 68,887,593 (GRCm39) V49I probably benign Het
Kdm2b A T 5: 123,120,842 (GRCm39) V101E probably damaging Het
Kidins220 A G 12: 25,061,018 (GRCm39) D790G probably damaging Het
Kif18a A G 2: 109,171,517 (GRCm39) T865A probably benign Het
Kif1b A G 4: 149,375,836 (GRCm39) V10A probably damaging Het
Kmt2d A T 15: 98,743,385 (GRCm39) M3925K unknown Het
Mcee G T 7: 64,061,730 (GRCm39) A178S possibly damaging Het
Megf10 A T 18: 57,375,773 (GRCm39) H233L probably benign Het
Meox1 T A 11: 101,769,482 (GRCm39) E238V probably benign Het
Myo5a G A 9: 75,043,631 (GRCm39) G207R probably damaging Het
Nemf T A 12: 69,359,436 (GRCm39) N966I possibly damaging Het
Or10q3 T C 19: 11,848,574 (GRCm39) E2G probably benign Het
Or1j14 A T 2: 36,417,777 (GRCm39) M118L probably damaging Het
Or5b123 G T 19: 13,597,344 (GRCm39) A230S probably benign Het
Or6c204 A G 10: 129,022,738 (GRCm39) I184T possibly damaging Het
Pfas T C 11: 68,883,542 (GRCm39) Q662R probably benign Het
Phf2 G T 13: 49,024,218 (GRCm39) C8* probably null Het
Pkhd1 T A 1: 20,617,690 (GRCm39) N965I probably benign Het
Plxnd1 C T 6: 115,940,274 (GRCm39) R1370Q possibly damaging Het
Prb1b T A 6: 132,289,218 (GRCm39) Q202L unknown Het
Prdm8 A T 5: 98,333,638 (GRCm39) T402S probably benign Het
Proz T A 8: 13,116,854 (GRCm39) D135E probably benign Het
Prtg T A 9: 72,813,493 (GRCm39) I951K probably damaging Het
Rasgef1b A T 5: 99,380,014 (GRCm39) Y288* probably null Het
Sacs T A 14: 61,443,428 (GRCm39) C1825S probably benign Het
Slc22a12 G C 19: 6,587,673 (GRCm39) P427R probably damaging Het
Slfn3 A G 11: 83,105,728 (GRCm39) Y575C probably damaging Het
St18 C T 1: 6,929,276 (GRCm39) T56I Het
Synrg T C 11: 83,910,696 (GRCm39) L876S probably damaging Het
Tchh T C 3: 93,354,666 (GRCm39) C1369R unknown Het
Tet2 G A 3: 133,193,064 (GRCm39) Q457* probably null Het
Thap12 T C 7: 98,364,495 (GRCm39) V221A probably damaging Het
Tor3a T A 1: 156,501,126 (GRCm39) D104V probably damaging Het
Trpc2 T C 7: 101,744,439 (GRCm39) V737A possibly damaging Het
Trpc4 A G 3: 54,129,699 (GRCm39) Y155C probably damaging Het
Tspyl1 T C 10: 34,159,135 (GRCm39) S287P possibly damaging Het
Ube2u TAGAAGAAGAAGAAGAAGAAGAAGAAGA TAGAAGAAGAAGAAGAAGAAGAAGA 4: 100,406,943 (GRCm39) probably benign Het
Ubr2 A G 17: 47,266,706 (GRCm39) probably null Het
Vmn1r238 T A 18: 3,122,635 (GRCm39) T260S probably benign Het
Other mutations in Atp10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Atp10b APN 11 43,092,988 (GRCm39) missense probably damaging 1.00
IGL01385:Atp10b APN 11 43,125,256 (GRCm39) missense probably damaging 1.00
IGL01524:Atp10b APN 11 43,150,672 (GRCm39) missense probably benign 0.18
IGL01575:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01588:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01590:Atp10b APN 11 43,063,548 (GRCm39) missense probably benign 0.00
IGL01832:Atp10b APN 11 43,125,262 (GRCm39) missense probably damaging 0.98
IGL01927:Atp10b APN 11 43,150,231 (GRCm39) splice site probably benign
IGL01933:Atp10b APN 11 43,085,457 (GRCm39) missense probably damaging 1.00
IGL02182:Atp10b APN 11 43,139,774 (GRCm39) missense probably damaging 1.00
IGL02215:Atp10b APN 11 43,085,492 (GRCm39) critical splice donor site probably null
IGL02216:Atp10b APN 11 43,150,616 (GRCm39) missense probably damaging 0.98
IGL02973:Atp10b APN 11 43,088,336 (GRCm39) missense probably damaging 1.00
IGL03012:Atp10b APN 11 43,085,482 (GRCm39) missense probably damaging 0.99
IGL03106:Atp10b APN 11 43,138,304 (GRCm39) missense probably benign 0.32
IGL03123:Atp10b APN 11 43,044,110 (GRCm39) missense probably benign 0.01
IGL03202:Atp10b APN 11 43,125,268 (GRCm39) critical splice donor site probably null
IGL03339:Atp10b APN 11 43,121,442 (GRCm39) missense probably null 0.71
R0053:Atp10b UTSW 11 43,107,391 (GRCm39) splice site probably benign
R0053:Atp10b UTSW 11 43,107,391 (GRCm39) splice site probably benign
R0098:Atp10b UTSW 11 43,080,431 (GRCm39) missense probably benign 0.00
R0098:Atp10b UTSW 11 43,080,431 (GRCm39) missense probably benign 0.00
R0281:Atp10b UTSW 11 43,044,131 (GRCm39) missense probably benign 0.00
R0379:Atp10b UTSW 11 43,145,141 (GRCm39) missense probably benign 0.05
R0380:Atp10b UTSW 11 43,116,424 (GRCm39) missense probably damaging 1.00
R0470:Atp10b UTSW 11 43,093,866 (GRCm39) missense possibly damaging 0.88
R1355:Atp10b UTSW 11 43,042,482 (GRCm39) nonsense probably null
R1368:Atp10b UTSW 11 43,092,981 (GRCm39) missense probably damaging 1.00
R1370:Atp10b UTSW 11 43,042,482 (GRCm39) nonsense probably null
R1413:Atp10b UTSW 11 43,121,391 (GRCm39) missense probably benign 0.00
R1502:Atp10b UTSW 11 43,121,174 (GRCm39) missense probably damaging 1.00
R1530:Atp10b UTSW 11 43,088,351 (GRCm39) missense probably benign 0.03
R1596:Atp10b UTSW 11 43,126,594 (GRCm39) missense probably damaging 1.00
R1675:Atp10b UTSW 11 43,116,475 (GRCm39) missense probably damaging 1.00
R1880:Atp10b UTSW 11 43,150,259 (GRCm39) missense probably damaging 1.00
R1938:Atp10b UTSW 11 43,121,245 (GRCm39) missense probably benign 0.00
R1986:Atp10b UTSW 11 43,063,595 (GRCm39) missense probably benign 0.12
R2081:Atp10b UTSW 11 43,092,955 (GRCm39) missense probably damaging 1.00
R2083:Atp10b UTSW 11 43,103,250 (GRCm39) missense probably benign 0.24
R2159:Atp10b UTSW 11 43,042,680 (GRCm39) missense possibly damaging 0.81
R2255:Atp10b UTSW 11 43,125,207 (GRCm39) missense probably damaging 1.00
R2259:Atp10b UTSW 11 43,080,440 (GRCm39) missense probably damaging 1.00
R2259:Atp10b UTSW 11 43,063,572 (GRCm39) missense probably damaging 1.00
R3741:Atp10b UTSW 11 43,126,489 (GRCm39) missense probably damaging 1.00
R3942:Atp10b UTSW 11 43,063,581 (GRCm39) missense probably damaging 1.00
R3971:Atp10b UTSW 11 43,107,339 (GRCm39) missense probably damaging 1.00
R4007:Atp10b UTSW 11 43,150,679 (GRCm39) missense probably benign 0.04
R4050:Atp10b UTSW 11 43,150,363 (GRCm39) missense probably benign 0.00
R4078:Atp10b UTSW 11 43,044,110 (GRCm39) missense probably benign 0.01
R4567:Atp10b UTSW 11 43,088,384 (GRCm39) missense probably benign 0.03
R4651:Atp10b UTSW 11 43,085,472 (GRCm39) missense probably damaging 1.00
R4652:Atp10b UTSW 11 43,085,472 (GRCm39) missense probably damaging 1.00
R4667:Atp10b UTSW 11 43,138,345 (GRCm39) missense probably damaging 1.00
R4720:Atp10b UTSW 11 43,093,949 (GRCm39) missense probably benign
R4987:Atp10b UTSW 11 43,042,440 (GRCm39) utr 5 prime probably benign
R5232:Atp10b UTSW 11 43,093,006 (GRCm39) missense probably damaging 1.00
R5233:Atp10b UTSW 11 43,121,387 (GRCm39) missense probably benign 0.06
R5281:Atp10b UTSW 11 43,145,163 (GRCm39) missense probably damaging 0.97
R5307:Atp10b UTSW 11 43,103,302 (GRCm39) missense probably damaging 1.00
R5460:Atp10b UTSW 11 43,121,282 (GRCm39) missense probably benign 0.00
R5518:Atp10b UTSW 11 43,042,463 (GRCm39) missense possibly damaging 0.84
R5659:Atp10b UTSW 11 43,136,252 (GRCm39) missense probably damaging 1.00
R5688:Atp10b UTSW 11 43,092,000 (GRCm39) missense probably benign 0.00
R5735:Atp10b UTSW 11 43,042,601 (GRCm39) missense probably benign 0.00
R6153:Atp10b UTSW 11 43,145,109 (GRCm39) missense probably damaging 1.00
R6251:Atp10b UTSW 11 43,126,573 (GRCm39) missense possibly damaging 0.95
R6259:Atp10b UTSW 11 43,092,065 (GRCm39) missense probably benign 0.24
R6394:Atp10b UTSW 11 43,116,464 (GRCm39) missense probably damaging 1.00
R6492:Atp10b UTSW 11 43,109,784 (GRCm39) missense probably damaging 1.00
R6769:Atp10b UTSW 11 43,094,079 (GRCm39) critical splice donor site probably null
R6771:Atp10b UTSW 11 43,094,079 (GRCm39) critical splice donor site probably null
R6775:Atp10b UTSW 11 43,113,040 (GRCm39) missense possibly damaging 0.80
R7134:Atp10b UTSW 11 43,136,291 (GRCm39) missense probably damaging 1.00
R7322:Atp10b UTSW 11 43,103,374 (GRCm39) missense probably damaging 1.00
R7367:Atp10b UTSW 11 43,138,328 (GRCm39) missense probably damaging 1.00
R7538:Atp10b UTSW 11 43,116,373 (GRCm39) missense probably benign 0.04
R7708:Atp10b UTSW 11 43,092,970 (GRCm39) missense probably damaging 1.00
R7787:Atp10b UTSW 11 43,150,700 (GRCm39) missense possibly damaging 0.91
R8145:Atp10b UTSW 11 43,092,949 (GRCm39) missense probably damaging 1.00
R8406:Atp10b UTSW 11 43,093,984 (GRCm39) missense probably benign 0.00
R8503:Atp10b UTSW 11 43,113,066 (GRCm39) missense possibly damaging 0.92
R8542:Atp10b UTSW 11 43,121,208 (GRCm39) missense probably benign 0.18
R8744:Atp10b UTSW 11 43,121,177 (GRCm39) missense probably damaging 1.00
R8815:Atp10b UTSW 11 43,093,978 (GRCm39) missense possibly damaging 0.63
R8833:Atp10b UTSW 11 43,112,986 (GRCm39) missense probably damaging 1.00
R8880:Atp10b UTSW 11 43,106,811 (GRCm39) missense probably benign
R8989:Atp10b UTSW 11 43,136,269 (GRCm39) nonsense probably null
R8998:Atp10b UTSW 11 43,150,726 (GRCm39) makesense probably null
R9255:Atp10b UTSW 11 43,107,148 (GRCm39) missense probably damaging 1.00
R9281:Atp10b UTSW 11 43,116,458 (GRCm39) missense probably benign 0.11
R9345:Atp10b UTSW 11 43,094,024 (GRCm39) missense probably damaging 0.99
R9357:Atp10b UTSW 11 43,150,711 (GRCm39) missense probably benign 0.18
R9393:Atp10b UTSW 11 43,063,608 (GRCm39) missense probably damaging 1.00
R9516:Atp10b UTSW 11 43,121,224 (GRCm39) missense probably benign 0.02
R9747:Atp10b UTSW 11 43,088,339 (GRCm39) missense probably benign
Z1177:Atp10b UTSW 11 43,044,176 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCCAAGATGGCTTCTCCCAATC -3'
(R):5'- GGGCAAACAATGAGTTCAGTC -3'

Sequencing Primer
(F):5'- AAGATGGCTTCTCCCAATCTCCATC -3'
(R):5'- GGGCAAACAATGAGTTCAGTCTCTTC -3'
Posted On 2022-09-12