Incidental Mutation 'R0765:Trim17'
ID72616
Institutional Source Beutler Lab
Gene Symbol Trim17
Ensembl Gene ENSMUSG00000036964
Gene Nametripartite motif-containing 17
Synonymsterf, Rnf16
MMRRC Submission 038945-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0765 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58954685-58973098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 58971369 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 409 (V409G)
Ref Sequence ENSEMBL: ENSMUSP00000074639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047697] [ENSMUST00000075141]
Predicted Effect probably benign
Transcript: ENSMUST00000047697
SMART Domains Protein: ENSMUSP00000037248
Gene: ENSMUSG00000036964

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075141
AA Change: V409G

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074639
Gene: ENSMUSG00000036964
AA Change: V409G

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
PRY 294 347 8.95e-16 SMART
SPRY 348 472 2.54e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131221
Meta Mutation Damage Score 0.8081 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein is expressed almost exclusively in the testis, but its function is unknown. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T A 5: 107,506,934 D354E probably benign Het
Abhd16a T A 17: 35,101,851 V425D probably benign Het
Ano9 T G 7: 141,107,184 I381L probably damaging Het
Apob C T 12: 8,016,518 L4496F probably benign Het
Arhgef38 C T 3: 133,116,583 E724K probably damaging Het
Atp8b4 T A 2: 126,372,150 probably null Het
Baiap2l1 G T 5: 144,277,703 P394T probably damaging Het
Cnbp C A 6: 87,845,173 C122F probably damaging Het
Col3a1 A G 1: 45,336,651 probably benign Het
Colq T G 14: 31,526,037 D408A possibly damaging Het
Cuzd1 A T 7: 131,316,095 S259T probably benign Het
Cyp3a57 A G 5: 145,390,410 probably benign Het
Dbn1 C A 13: 55,482,294 V112F probably damaging Het
Dcc T A 18: 71,362,990 D1028V probably damaging Het
Dnajb11 T C 16: 22,862,568 V32A probably damaging Het
Dsg4 G A 18: 20,454,646 probably benign Het
Dyrk1b C T 7: 28,185,711 probably benign Het
Ebf1 T A 11: 44,869,160 M208K probably damaging Het
Efhc1 A G 1: 20,978,652 I430V probably benign Het
Elovl2 T C 13: 41,187,466 Y181C probably benign Het
Fras1 A G 5: 96,552,796 Q225R probably benign Het
Frmd3 G A 4: 74,161,767 R332Q probably damaging Het
Glg1 A G 8: 111,159,797 probably null Het
Hmcn1 G A 1: 150,808,787 T344M probably damaging Het
Il1rap T G 16: 26,710,632 probably null Het
Klra1 A T 6: 130,379,092 probably benign Het
Larp7 C A 3: 127,546,165 K289N probably damaging Het
Lgr6 C A 1: 134,993,886 G240V probably benign Het
Lrp10 G T 14: 54,468,090 D246Y probably damaging Het
Map3k20 G A 2: 72,371,925 V167I probably damaging Het
Med23 T C 10: 24,900,710 S347P probably damaging Het
Mybph T C 1: 134,197,496 V254A possibly damaging Het
Ndufv2 A G 17: 66,101,078 probably benign Het
Nuf2 A T 1: 169,522,936 probably benign Het
Nup210l T C 3: 90,119,877 Y189H probably damaging Het
Olfr1025-ps1 T C 2: 85,918,705 L260P probably damaging Het
Olfr1263 G A 2: 90,015,670 V247I probably benign Het
Olfr574 C T 7: 102,948,732 T79I probably damaging Het
Pdgfra C A 5: 75,187,987 probably benign Het
Phlpp1 T C 1: 106,392,283 L1336P probably damaging Het
Prpf38b T C 3: 108,911,418 T9A possibly damaging Het
Rnf213 G A 11: 119,423,095 probably null Het
Saal1 A T 7: 46,699,647 V281E possibly damaging Het
Slc17a3 C T 13: 23,846,896 Q186* probably null Het
Slc6a2 A G 8: 92,989,031 T266A probably damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
Srfbp1 T C 18: 52,490,435 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tesk1 C T 4: 43,446,706 P365S possibly damaging Het
Tmem127 C A 2: 127,257,149 T201K probably damaging Het
Trim43c C T 9: 88,841,916 T165I probably benign Het
Ush2a C A 1: 188,948,574 F4916L possibly damaging Het
Vmn1r89 A G 7: 13,219,540 M68V probably benign Het
Vmn2r105 C T 17: 20,227,711 E284K probably benign Het
Vmn2r105 T C 17: 20,227,857 D235G probably damaging Het
Vmn2r-ps134 C T 17: 23,446,041 noncoding transcript Het
Zdbf2 G A 1: 63,305,723 S1087N possibly damaging Het
Zfp534 G A 4: 147,674,236 P659S probably damaging Het
Other mutations in Trim17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Trim17 APN 11 58970597 missense probably damaging 1.00
IGL02581:Trim17 APN 11 58971076 nonsense probably null
P0026:Trim17 UTSW 11 58971258 missense possibly damaging 0.83
R0518:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R0521:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R1165:Trim17 UTSW 11 58971215 missense possibly damaging 0.92
R1441:Trim17 UTSW 11 58965192 missense probably damaging 1.00
R2164:Trim17 UTSW 11 58971411 missense probably damaging 1.00
R2320:Trim17 UTSW 11 58966798 missense probably benign
R3436:Trim17 UTSW 11 58965233 missense probably damaging 1.00
R4715:Trim17 UTSW 11 58968450 intron probably benign
R4832:Trim17 UTSW 11 58971444 missense probably damaging 0.97
R4928:Trim17 UTSW 11 58954301 unclassified probably benign
R4950:Trim17 UTSW 11 58970428 missense probably damaging 0.98
R5339:Trim17 UTSW 11 58954510 splice site probably null
R5909:Trim17 UTSW 11 58968680 missense probably damaging 1.00
R5915:Trim17 UTSW 11 58968562 missense probably damaging 0.99
R5947:Trim17 UTSW 11 58965543 missense probably damaging 1.00
R6732:Trim17 UTSW 11 58971025 critical splice acceptor site probably null
R7027:Trim17 UTSW 11 58968616 missense probably benign 0.08
R7143:Trim17 UTSW 11 58965184 nonsense probably null
R7168:Trim17 UTSW 11 58968578 missense probably benign
R7682:Trim17 UTSW 11 58966808 missense possibly damaging 0.82
R7707:Trim17 UTSW 11 58965284 nonsense probably null
R7972:Trim17 UTSW 11 58968568 missense probably benign 0.01
Z1177:Trim17 UTSW 11 58965389 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTACTGGGAAGTGGGCATGAATC -3'
(R):5'- CCCTGCCAGCACAGGTATTAACTC -3'

Sequencing Primer
(F):5'- AGTGGGCATGAATCTCACC -3'
(R):5'- CACTGTGGAGATGACCATCTG -3'
Posted On2013-09-30