Incidental Mutation 'R9644:Nemf'
ID 726165
Institutional Source Beutler Lab
Gene Symbol Nemf
Ensembl Gene ENSMUSG00000020982
Gene Name nuclear export mediator factor
Synonyms 1500011I12Rik, 4933405E14Rik, Sdccag1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9644 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 69310522-69357165 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 69312662 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 966 (N966I)
Ref Sequence ENSEMBL: ENSMUSP00000021368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021362] [ENSMUST00000021368]
AlphaFold Q8CCP0
Predicted Effect probably benign
Transcript: ENSMUST00000021362
SMART Domains Protein: ENSMUSP00000021362
Gene: ENSMUSG00000020978

DomainStartEndE-ValueType
internal_repeat_1 7 117 3.66e-6 PROSPERO
internal_repeat_2 66 163 6.25e-5 PROSPERO
Pfam:Kelch_1 217 258 1.4e-6 PFAM
Pfam:Kelch_2 217 262 1.2e-7 PFAM
Pfam:Kelch_4 217 266 8.4e-8 PFAM
Pfam:Kelch_3 227 276 5.1e-9 PFAM
Pfam:Kelch_5 265 305 1.4e-6 PFAM
Pfam:Kelch_4 267 310 2e-9 PFAM
Pfam:Kelch_3 278 326 1.4e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000021368
AA Change: N966I

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021368
Gene: ENSMUSG00000020982
AA Change: N966I

DomainStartEndE-ValueType
Pfam:FbpA 6 523 5.5e-42 PFAM
Pfam:DUF814 530 630 9e-27 PFAM
low complexity region 697 708 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
low complexity region 894 918 N/A INTRINSIC
Pfam:DUF3441 956 1055 9.8e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the ribosome quality control complex. The encoded protein facilitates the recognition and ubiquitination of stalled 60S subunits by the ubiquitin ligase listerin. A similar protein in fly functions as a tumor suppressor. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,186,295 S32* probably null Het
Adam34 T A 8: 43,651,729 H293L probably damaging Het
Adgrl3 A G 5: 81,724,189 N910S probably damaging Het
Ankrd11 C T 8: 122,890,943 A2057T probably benign Het
Ankrd36 A G 11: 5,643,835 D480G possibly damaging Het
Aox4 T A 1: 58,228,119 D185E probably benign Het
Apol8 C A 15: 77,749,495 V294L probably damaging Het
Arsk G A 13: 76,072,108 A289V probably damaging Het
Atg101 A G 15: 101,290,566 D184G probably benign Het
Atp10b C T 11: 43,151,832 T73I probably damaging Het
Ccser2 A T 14: 36,879,193 N411K possibly damaging Het
Cct5 A G 15: 31,601,699 S3P probably benign Het
Chn1 A T 2: 73,659,840 I31K probably benign Het
Clec2e T A 6: 129,093,480 I193L probably benign Het
Crim1 G A 17: 78,280,068 G201R probably damaging Het
Ctrc A G 4: 141,845,025 V68A probably damaging Het
Dennd4c T A 4: 86,795,126 I438N probably damaging Het
Dnah5 T A 15: 28,230,504 W183R probably damaging Het
Dnali1 T A 4: 125,056,609 I253F probably damaging Het
Dyrk1b T C 7: 28,182,365 L83P probably damaging Het
Emx2 T C 19: 59,463,995 I237T probably benign Het
Enpp3 C T 10: 24,809,903 R198K probably damaging Het
Epb41l1 C T 2: 156,525,245 P678L possibly damaging Het
Epm2aip1 C T 9: 111,273,069 T370I probably damaging Het
Fam184a T G 10: 53,697,246 Q346P probably damaging Het
Foxi2 A C 7: 135,411,998 H319P possibly damaging Het
Gatad1 A G 5: 3,641,442 V250A possibly damaging Het
Gmeb1 T C 4: 132,232,129 I205V probably benign Het
Gucy2g C G 19: 55,231,105 V362L probably benign Het
Hace1 T C 10: 45,649,905 S281P probably benign Het
Helz C A 11: 107,672,861 A1709D unknown Het
Igf2bp2 T A 16: 22,083,985 N115Y probably damaging Het
Igkv4-86 C T 6: 68,910,609 V49I probably benign Het
Kdm2b A T 5: 122,982,779 V101E probably damaging Het
Kidins220 A G 12: 25,011,019 D790G probably damaging Het
Kif18a A G 2: 109,341,172 T865A probably benign Het
Kif1b A G 4: 149,291,379 V10A probably damaging Het
Kmt2d A T 15: 98,845,504 M3925K unknown Het
Mcee G T 7: 64,411,982 A178S possibly damaging Het
Megf10 A T 18: 57,242,701 H233L probably benign Het
Meox1 T A 11: 101,878,656 E238V probably benign Het
Myo5a G A 9: 75,136,349 G207R probably damaging Het
Olfr1419 T C 19: 11,871,210 E2G probably benign Het
Olfr1487 G T 19: 13,619,980 A230S probably benign Het
Olfr342 A T 2: 36,527,765 M118L probably damaging Het
Olfr773 A G 10: 129,186,869 I184T possibly damaging Het
Pfas T C 11: 68,992,716 Q662R probably benign Het
Phf2 G T 13: 48,870,742 C8* probably null Het
Pkhd1 T A 1: 20,547,466 N965I probably benign Het
Plxnd1 C T 6: 115,963,313 R1370Q possibly damaging Het
Prdm8 A T 5: 98,185,779 T402S probably benign Het
Proz T A 8: 13,066,854 D135E probably benign Het
Prpmp5 T A 6: 132,312,255 Q202L unknown Het
Prtg T A 9: 72,906,211 I951K probably damaging Het
Rasgef1b A T 5: 99,232,155 Y288* probably null Het
Sacs T A 14: 61,205,979 C1825S probably benign Het
Slc22a12 G C 19: 6,537,643 P427R probably damaging Het
Slfn3 A G 11: 83,214,902 Y575C probably damaging Het
St18 C T 1: 6,859,052 T56I Het
Synrg T C 11: 84,019,870 L876S probably damaging Het
Tchh T C 3: 93,447,359 C1369R unknown Het
Tet2 G A 3: 133,487,303 Q457* probably null Het
Thap12 T C 7: 98,715,288 V221A probably damaging Het
Tor3a T A 1: 156,673,556 D104V probably damaging Het
Trpc2 T C 7: 102,095,232 V737A possibly damaging Het
Trpc4 A G 3: 54,222,278 Y155C probably damaging Het
Tspyl1 T C 10: 34,283,139 S287P possibly damaging Het
Ube2u TAGAAGAAGAAGAAGAAGAAGAAGAAGA TAGAAGAAGAAGAAGAAGAAGAAGA 4: 100,549,746 probably benign Het
Ubr2 A G 17: 46,955,780 probably null Het
Vmn1r238 T A 18: 3,122,635 T260S probably benign Het
Wisp1 T G 15: 66,912,936 C153G Het
Other mutations in Nemf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Nemf APN 12 69344986 splice site probably benign
IGL02499:Nemf APN 12 69322129 missense probably damaging 1.00
IGL03352:Nemf APN 12 69331905 missense probably damaging 1.00
kaempfer UTSW 12 69352336 missense probably benign 0.01
R0335:Nemf UTSW 12 69353803 missense probably benign 0.16
R0538:Nemf UTSW 12 69356314 missense probably damaging 1.00
R0581:Nemf UTSW 12 69322271 missense probably benign
R0909:Nemf UTSW 12 69341610 missense probably damaging 1.00
R1792:Nemf UTSW 12 69312569 missense probably damaging 1.00
R1899:Nemf UTSW 12 69346378 missense probably null
R2080:Nemf UTSW 12 69353786 splice site probably benign
R3704:Nemf UTSW 12 69331130 missense probably damaging 1.00
R3842:Nemf UTSW 12 69331949 missense probably damaging 0.98
R4471:Nemf UTSW 12 69314442 missense probably benign 0.04
R4666:Nemf UTSW 12 69312280 missense probably damaging 1.00
R4720:Nemf UTSW 12 69324288 missense probably benign 0.05
R5198:Nemf UTSW 12 69356047 missense probably damaging 1.00
R5474:Nemf UTSW 12 69316335 missense probably benign 0.03
R6893:Nemf UTSW 12 69352336 missense probably benign 0.01
R7008:Nemf UTSW 12 69341621 missense possibly damaging 0.91
R7008:Nemf UTSW 12 69353793 critical splice donor site probably null
R7098:Nemf UTSW 12 69312467 missense probably damaging 1.00
R7154:Nemf UTSW 12 69316741 critical splice donor site probably null
R7452:Nemf UTSW 12 69337959 splice site probably null
R8130:Nemf UTSW 12 69356052 missense possibly damaging 0.91
R8340:Nemf UTSW 12 69353885 missense possibly damaging 0.94
R8914:Nemf UTSW 12 69316315 nonsense probably null
R9089:Nemf UTSW 12 69353854 missense probably damaging 1.00
R9150:Nemf UTSW 12 69341046 missense probably benign 0.00
R9228:Nemf UTSW 12 69341319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGTTACTACATGGAGATCAAAG -3'
(R):5'- GAACTGTAAGCAGAATTTGGGTAC -3'

Sequencing Primer
(F):5'- GATTCCTAAAGCTACTTGGCAATGAG -3'
(R):5'- TGTCAGATTGTATGTCAGAAAAGGC -3'
Posted On 2022-09-12