Incidental Mutation 'R9644:Ubr2'
ID 726177
Institutional Source Beutler Lab
Gene Symbol Ubr2
Ensembl Gene ENSMUSG00000023977
Gene Name ubiquitin protein ligase E3 component n-recognin 2
Synonyms 9930021A08Rik, E130209G04Rik, ENSMUSG00000043296
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock # R9644 (G1)
Quality Score 222.009
Status Not validated
Chromosome 17
Chromosomal Location 46928295-47010556 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 46955780 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113335] [ENSMUST00000113335] [ENSMUST00000113337] [ENSMUST00000225599]
AlphaFold Q6WKZ8
Predicted Effect probably null
Transcript: ENSMUST00000113335
SMART Domains Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 221 302 2.4e-23 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113335
SMART Domains Protein: ENSMUSP00000108961
Gene: ENSMUSG00000023977

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 221 302 2.4e-23 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113337
SMART Domains Protein: ENSMUSP00000108963
Gene: ENSMUSG00000023977

DomainStartEndE-ValueType
ZnF_UBR1 97 167 3.14e-32 SMART
Pfam:ClpS 222 301 6.2e-26 PFAM
low complexity region 635 646 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 872 886 N/A INTRINSIC
coiled coil region 1019 1046 N/A INTRINSIC
RING 1108 1213 7.66e-1 SMART
low complexity region 1221 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225599
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase of the N-end rule proteolytic pathway that targets proteins with destabilizing N-terminal residues for polyubiquitylation and proteasome-mediated degradation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: On a mixed genetic background, female homozygotes for a targeted null mutation exhibit embryonic lethality, while males are viable, but sterile due to postnatal testicular degeneration. On an inbred background, both genders die in utero. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,186,295 S32* probably null Het
Adam34 T A 8: 43,651,729 H293L probably damaging Het
Adgrl3 A G 5: 81,724,189 N910S probably damaging Het
Ankrd11 C T 8: 122,890,943 A2057T probably benign Het
Ankrd36 A G 11: 5,643,835 D480G possibly damaging Het
Aox4 T A 1: 58,228,119 D185E probably benign Het
Apol8 C A 15: 77,749,495 V294L probably damaging Het
Arsk G A 13: 76,072,108 A289V probably damaging Het
Atg101 A G 15: 101,290,566 D184G probably benign Het
Atp10b C T 11: 43,151,832 T73I probably damaging Het
Ccser2 A T 14: 36,879,193 N411K possibly damaging Het
Cct5 A G 15: 31,601,699 S3P probably benign Het
Chn1 A T 2: 73,659,840 I31K probably benign Het
Clec2e T A 6: 129,093,480 I193L probably benign Het
Crim1 G A 17: 78,280,068 G201R probably damaging Het
Ctrc A G 4: 141,845,025 V68A probably damaging Het
Dennd4c T A 4: 86,795,126 I438N probably damaging Het
Dnah5 T A 15: 28,230,504 W183R probably damaging Het
Dnali1 T A 4: 125,056,609 I253F probably damaging Het
Dyrk1b T C 7: 28,182,365 L83P probably damaging Het
Emx2 T C 19: 59,463,995 I237T probably benign Het
Enpp3 C T 10: 24,809,903 R198K probably damaging Het
Epb41l1 C T 2: 156,525,245 P678L possibly damaging Het
Epm2aip1 C T 9: 111,273,069 T370I probably damaging Het
Fam184a T G 10: 53,697,246 Q346P probably damaging Het
Foxi2 A C 7: 135,411,998 H319P possibly damaging Het
Gatad1 A G 5: 3,641,442 V250A possibly damaging Het
Gmeb1 T C 4: 132,232,129 I205V probably benign Het
Gucy2g C G 19: 55,231,105 V362L probably benign Het
Hace1 T C 10: 45,649,905 S281P probably benign Het
Helz C A 11: 107,672,861 A1709D unknown Het
Igf2bp2 T A 16: 22,083,985 N115Y probably damaging Het
Igkv4-86 C T 6: 68,910,609 V49I probably benign Het
Kdm2b A T 5: 122,982,779 V101E probably damaging Het
Kidins220 A G 12: 25,011,019 D790G probably damaging Het
Kif18a A G 2: 109,341,172 T865A probably benign Het
Kif1b A G 4: 149,291,379 V10A probably damaging Het
Kmt2d A T 15: 98,845,504 M3925K unknown Het
Mcee G T 7: 64,411,982 A178S possibly damaging Het
Megf10 A T 18: 57,242,701 H233L probably benign Het
Meox1 T A 11: 101,878,656 E238V probably benign Het
Myo5a G A 9: 75,136,349 G207R probably damaging Het
Nemf T A 12: 69,312,662 N966I possibly damaging Het
Olfr1419 T C 19: 11,871,210 E2G probably benign Het
Olfr1487 G T 19: 13,619,980 A230S probably benign Het
Olfr342 A T 2: 36,527,765 M118L probably damaging Het
Olfr773 A G 10: 129,186,869 I184T possibly damaging Het
Pfas T C 11: 68,992,716 Q662R probably benign Het
Phf2 G T 13: 48,870,742 C8* probably null Het
Pkhd1 T A 1: 20,547,466 N965I probably benign Het
Plxnd1 C T 6: 115,963,313 R1370Q possibly damaging Het
Prdm8 A T 5: 98,185,779 T402S probably benign Het
Proz T A 8: 13,066,854 D135E probably benign Het
Prpmp5 T A 6: 132,312,255 Q202L unknown Het
Prtg T A 9: 72,906,211 I951K probably damaging Het
Rasgef1b A T 5: 99,232,155 Y288* probably null Het
Sacs T A 14: 61,205,979 C1825S probably benign Het
Slc22a12 G C 19: 6,537,643 P427R probably damaging Het
Slfn3 A G 11: 83,214,902 Y575C probably damaging Het
St18 C T 1: 6,859,052 T56I Het
Synrg T C 11: 84,019,870 L876S probably damaging Het
Tchh T C 3: 93,447,359 C1369R unknown Het
Tet2 G A 3: 133,487,303 Q457* probably null Het
Thap12 T C 7: 98,715,288 V221A probably damaging Het
Tor3a T A 1: 156,673,556 D104V probably damaging Het
Trpc2 T C 7: 102,095,232 V737A possibly damaging Het
Trpc4 A G 3: 54,222,278 Y155C probably damaging Het
Tspyl1 T C 10: 34,283,139 S287P possibly damaging Het
Ube2u TAGAAGAAGAAGAAGAAGAAGAAGAAGA TAGAAGAAGAAGAAGAAGAAGAAGA 4: 100,549,746 probably benign Het
Vmn1r238 T A 18: 3,122,635 T260S probably benign Het
Wisp1 T G 15: 66,912,936 C153G Het
Other mutations in Ubr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ubr2 APN 17 46986060 splice site probably benign
IGL00332:Ubr2 APN 17 46990990 critical splice donor site probably null
IGL00518:Ubr2 APN 17 46992996 missense probably damaging 1.00
IGL00693:Ubr2 APN 17 46972981 missense probably benign 0.01
IGL00785:Ubr2 APN 17 46944865 missense possibly damaging 0.69
IGL01144:Ubr2 APN 17 46957321 missense probably damaging 1.00
IGL01459:Ubr2 APN 17 46930509 splice site probably benign
IGL01637:Ubr2 APN 17 46956654 missense probably damaging 1.00
IGL01710:Ubr2 APN 17 46943409 missense probably benign 0.00
IGL01726:Ubr2 APN 17 46992981 splice site probably benign
IGL01925:Ubr2 APN 17 46954949 missense possibly damaging 0.92
IGL01960:Ubr2 APN 17 46973967 missense probably benign 0.45
IGL02170:Ubr2 APN 17 46967197 missense probably benign 0.05
IGL02308:Ubr2 APN 17 46934193 missense probably damaging 1.00
IGL02387:Ubr2 APN 17 46963150 missense probably benign
IGL02696:Ubr2 APN 17 46963765 missense probably benign
IGL02726:Ubr2 APN 17 46972921 missense probably damaging 1.00
IGL02750:Ubr2 APN 17 46969282 missense probably benign 0.00
IGL02934:Ubr2 APN 17 46957340 missense possibly damaging 0.50
IGL02959:Ubr2 APN 17 46975951 missense probably damaging 0.96
IGL03018:Ubr2 APN 17 46954046 missense possibly damaging 0.64
IGL03343:Ubr2 APN 17 46951918 missense probably benign 0.00
PIT4280001:Ubr2 UTSW 17 46944863 missense probably damaging 1.00
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0044:Ubr2 UTSW 17 46992985 splice site probably benign
R0446:Ubr2 UTSW 17 46983298 missense probably damaging 1.00
R0513:Ubr2 UTSW 17 46986779 nonsense probably null
R0565:Ubr2 UTSW 17 46955886 missense probably damaging 1.00
R0600:Ubr2 UTSW 17 46967248 missense probably damaging 0.99
R0690:Ubr2 UTSW 17 46938653 missense probably damaging 0.97
R0710:Ubr2 UTSW 17 46938681 missense probably damaging 0.96
R0761:Ubr2 UTSW 17 46983316 missense probably damaging 1.00
R0798:Ubr2 UTSW 17 46969176 splice site probably benign
R0862:Ubr2 UTSW 17 46967083 nonsense probably null
R0947:Ubr2 UTSW 17 46941112 missense probably damaging 0.99
R0972:Ubr2 UTSW 17 46934261 splice site probably null
R1500:Ubr2 UTSW 17 46986689 missense possibly damaging 0.79
R1514:Ubr2 UTSW 17 47000823 missense probably damaging 1.00
R1533:Ubr2 UTSW 17 46967247 nonsense probably null
R1554:Ubr2 UTSW 17 46972951 missense probably benign
R1575:Ubr2 UTSW 17 46932492 missense probably damaging 1.00
R1602:Ubr2 UTSW 17 46941061 missense probably benign 0.30
R1941:Ubr2 UTSW 17 46974026 missense probably damaging 1.00
R1966:Ubr2 UTSW 17 46954919 missense probably benign 0.05
R2041:Ubr2 UTSW 17 46986047 missense probably damaging 1.00
R2067:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2111:Ubr2 UTSW 17 46963145 critical splice donor site probably null
R2189:Ubr2 UTSW 17 46943364 missense probably benign 0.01
R2219:Ubr2 UTSW 17 46986042 missense possibly damaging 0.94
R2307:Ubr2 UTSW 17 46966215 nonsense probably null
R3426:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3428:Ubr2 UTSW 17 46968439 missense probably damaging 1.00
R3608:Ubr2 UTSW 17 46944523 missense probably damaging 1.00
R4080:Ubr2 UTSW 17 46988722 missense probably benign 0.05
R4330:Ubr2 UTSW 17 46967278 missense probably null 1.00
R4383:Ubr2 UTSW 17 46939387 missense probably benign 0.01
R4460:Ubr2 UTSW 17 46945045 critical splice donor site probably null
R4794:Ubr2 UTSW 17 46930445 missense probably damaging 1.00
R4902:Ubr2 UTSW 17 46985996 missense possibly damaging 0.91
R4913:Ubr2 UTSW 17 46959459 splice site probably null
R5092:Ubr2 UTSW 17 46969247 missense probably damaging 1.00
R5209:Ubr2 UTSW 17 46968424 missense probably damaging 1.00
R5226:Ubr2 UTSW 17 46983270 missense probably benign 0.04
R5250:Ubr2 UTSW 17 46930442 missense probably benign 0.01
R5437:Ubr2 UTSW 17 46963697 missense probably benign 0.00
R5607:Ubr2 UTSW 17 46934200 nonsense probably null
R5848:Ubr2 UTSW 17 46956655 missense possibly damaging 0.84
R6089:Ubr2 UTSW 17 46982292 missense possibly damaging 0.95
R6382:Ubr2 UTSW 17 46957315 missense possibly damaging 0.56
R6552:Ubr2 UTSW 17 46966268 splice site probably null
R6630:Ubr2 UTSW 17 46951984 missense possibly damaging 0.51
R6892:Ubr2 UTSW 17 46934108 missense probably damaging 0.99
R6936:Ubr2 UTSW 17 46973031 missense possibly damaging 0.94
R7039:Ubr2 UTSW 17 47010213 missense probably benign 0.01
R7050:Ubr2 UTSW 17 46961602 missense probably benign 0.30
R7078:Ubr2 UTSW 17 46955853 missense possibly damaging 0.59
R7126:Ubr2 UTSW 17 46974056 splice site probably null
R7219:Ubr2 UTSW 17 46935434 nonsense probably null
R7262:Ubr2 UTSW 17 47000739 missense probably damaging 0.97
R7352:Ubr2 UTSW 17 46930426 missense probably benign 0.19
R7366:Ubr2 UTSW 17 46955845 missense probably damaging 0.99
R7449:Ubr2 UTSW 17 46964788 missense probably damaging 1.00
R7496:Ubr2 UTSW 17 46990991 critical splice donor site probably null
R7759:Ubr2 UTSW 17 46986048 missense probably damaging 1.00
R7869:Ubr2 UTSW 17 46991008 missense probably benign 0.00
R7916:Ubr2 UTSW 17 46968382 critical splice donor site probably null
R8236:Ubr2 UTSW 17 46951909 missense probably benign
R8376:Ubr2 UTSW 17 46942795 missense probably benign 0.07
R9026:Ubr2 UTSW 17 46934115 missense probably damaging 1.00
R9216:Ubr2 UTSW 17 46981359 missense probably benign 0.36
R9339:Ubr2 UTSW 17 46973939 missense probably benign 0.30
R9558:Ubr2 UTSW 17 46951917 missense probably benign
R9606:Ubr2 UTSW 17 46934094 missense probably damaging 1.00
R9731:Ubr2 UTSW 17 46963145 critical splice donor site probably null
X0027:Ubr2 UTSW 17 47000629 missense probably damaging 0.99
X0061:Ubr2 UTSW 17 46970111 missense possibly damaging 0.88
Z1177:Ubr2 UTSW 17 46959509 missense probably benign
Z1177:Ubr2 UTSW 17 47000766 missense possibly damaging 0.76
Z1177:Ubr2 UTSW 17 47010143 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GCCTCATGCCCTGATCTCAAAG -3'
(R):5'- CGTTTCAGACGCAGCTCTTAC -3'

Sequencing Primer
(F):5'- TGCCCTGATCTCAAAGCAGAAATG -3'
(R):5'- TCTTACAGCACTGGGCCC -3'
Posted On 2022-09-12