Incidental Mutation 'R9644:Megf10'
ID 726180
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Name multiple EGF-like-domains 10
Synonyms 3000002B06Rik, LOC240312
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock # R9644 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 57133090-57297467 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57242701 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 233 (H233L)
Ref Sequence ENSEMBL: ENSMUSP00000075174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
AlphaFold Q6DIB5
Predicted Effect probably benign
Transcript: ENSMUST00000075770
AA Change: H233L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: H233L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139892
AA Change: H233L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: H233L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,186,295 S32* probably null Het
Adam34 T A 8: 43,651,729 H293L probably damaging Het
Adgrl3 A G 5: 81,724,189 N910S probably damaging Het
Ankrd11 C T 8: 122,890,943 A2057T probably benign Het
Ankrd36 A G 11: 5,643,835 D480G possibly damaging Het
Aox4 T A 1: 58,228,119 D185E probably benign Het
Apol8 C A 15: 77,749,495 V294L probably damaging Het
Arsk G A 13: 76,072,108 A289V probably damaging Het
Atg101 A G 15: 101,290,566 D184G probably benign Het
Atp10b C T 11: 43,151,832 T73I probably damaging Het
Ccser2 A T 14: 36,879,193 N411K possibly damaging Het
Cct5 A G 15: 31,601,699 S3P probably benign Het
Chn1 A T 2: 73,659,840 I31K probably benign Het
Clec2e T A 6: 129,093,480 I193L probably benign Het
Crim1 G A 17: 78,280,068 G201R probably damaging Het
Ctrc A G 4: 141,845,025 V68A probably damaging Het
Dennd4c T A 4: 86,795,126 I438N probably damaging Het
Dnah5 T A 15: 28,230,504 W183R probably damaging Het
Dnali1 T A 4: 125,056,609 I253F probably damaging Het
Dyrk1b T C 7: 28,182,365 L83P probably damaging Het
Emx2 T C 19: 59,463,995 I237T probably benign Het
Enpp3 C T 10: 24,809,903 R198K probably damaging Het
Epb41l1 C T 2: 156,525,245 P678L possibly damaging Het
Epm2aip1 C T 9: 111,273,069 T370I probably damaging Het
Fam184a T G 10: 53,697,246 Q346P probably damaging Het
Foxi2 A C 7: 135,411,998 H319P possibly damaging Het
Gatad1 A G 5: 3,641,442 V250A possibly damaging Het
Gmeb1 T C 4: 132,232,129 I205V probably benign Het
Gucy2g C G 19: 55,231,105 V362L probably benign Het
Hace1 T C 10: 45,649,905 S281P probably benign Het
Helz C A 11: 107,672,861 A1709D unknown Het
Igf2bp2 T A 16: 22,083,985 N115Y probably damaging Het
Igkv4-86 C T 6: 68,910,609 V49I probably benign Het
Kdm2b A T 5: 122,982,779 V101E probably damaging Het
Kidins220 A G 12: 25,011,019 D790G probably damaging Het
Kif18a A G 2: 109,341,172 T865A probably benign Het
Kif1b A G 4: 149,291,379 V10A probably damaging Het
Kmt2d A T 15: 98,845,504 M3925K unknown Het
Mcee G T 7: 64,411,982 A178S possibly damaging Het
Meox1 T A 11: 101,878,656 E238V probably benign Het
Myo5a G A 9: 75,136,349 G207R probably damaging Het
Nemf T A 12: 69,312,662 N966I possibly damaging Het
Olfr1419 T C 19: 11,871,210 E2G probably benign Het
Olfr1487 G T 19: 13,619,980 A230S probably benign Het
Olfr342 A T 2: 36,527,765 M118L probably damaging Het
Olfr773 A G 10: 129,186,869 I184T possibly damaging Het
Pfas T C 11: 68,992,716 Q662R probably benign Het
Phf2 G T 13: 48,870,742 C8* probably null Het
Pkhd1 T A 1: 20,547,466 N965I probably benign Het
Plxnd1 C T 6: 115,963,313 R1370Q possibly damaging Het
Prdm8 A T 5: 98,185,779 T402S probably benign Het
Proz T A 8: 13,066,854 D135E probably benign Het
Prpmp5 T A 6: 132,312,255 Q202L unknown Het
Prtg T A 9: 72,906,211 I951K probably damaging Het
Rasgef1b A T 5: 99,232,155 Y288* probably null Het
Sacs T A 14: 61,205,979 C1825S probably benign Het
Slc22a12 G C 19: 6,537,643 P427R probably damaging Het
Slfn3 A G 11: 83,214,902 Y575C probably damaging Het
St18 C T 1: 6,859,052 T56I Het
Synrg T C 11: 84,019,870 L876S probably damaging Het
Tchh T C 3: 93,447,359 C1369R unknown Het
Tet2 G A 3: 133,487,303 Q457* probably null Het
Thap12 T C 7: 98,715,288 V221A probably damaging Het
Tor3a T A 1: 156,673,556 D104V probably damaging Het
Trpc2 T C 7: 102,095,232 V737A possibly damaging Het
Trpc4 A G 3: 54,222,278 Y155C probably damaging Het
Tspyl1 T C 10: 34,283,139 S287P possibly damaging Het
Ube2u TAGAAGAAGAAGAAGAAGAAGAAGAAGA TAGAAGAAGAAGAAGAAGAAGAAGA 4: 100,549,746 probably benign Het
Ubr2 A G 17: 46,955,780 probably null Het
Vmn1r238 T A 18: 3,122,635 T260S probably benign Het
Wisp1 T G 15: 66,912,936 C153G Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57240628 missense probably damaging 1.00
IGL00736:Megf10 APN 18 57292710 missense probably benign 0.35
IGL01631:Megf10 APN 18 57259797 missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57292632 missense probably damaging 1.00
IGL02747:Megf10 APN 18 57290493 missense probably benign 0.43
IGL03298:Megf10 APN 18 57283838 nonsense probably null
deep UTSW 18 57262131 missense probably damaging 1.00
megalodon UTSW 18 57287976 nonsense probably null
sharkie UTSW 18 57191185 nonsense probably null
IGL03046:Megf10 UTSW 18 57287983 missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57277688 missense probably damaging 1.00
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57259802 missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57252982 missense probably benign 0.34
R0602:Megf10 UTSW 18 57262100 missense probably damaging 0.98
R0630:Megf10 UTSW 18 57287995 missense probably benign 0.14
R0652:Megf10 UTSW 18 57277724 missense probably benign 0.00
R0658:Megf10 UTSW 18 57252896 missense probably benign 0.00
R0761:Megf10 UTSW 18 57287976 nonsense probably null
R1013:Megf10 UTSW 18 57261219 missense probably benign 0.00
R1130:Megf10 UTSW 18 57262006 missense probably benign 0.06
R1451:Megf10 UTSW 18 57252859 missense probably damaging 0.97
R1699:Megf10 UTSW 18 57277730 splice site probably null
R1729:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1784:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1870:Megf10 UTSW 18 57191185 nonsense probably null
R1961:Megf10 UTSW 18 57212354 missense probably damaging 0.97
R2094:Megf10 UTSW 18 57281713 nonsense probably null
R2213:Megf10 UTSW 18 57288009 nonsense probably null
R2853:Megf10 UTSW 18 57293931 missense probably damaging 1.00
R3772:Megf10 UTSW 18 57283862 missense probably benign 0.39
R3774:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3775:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3776:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3858:Megf10 UTSW 18 57275835 splice site probably benign
R3911:Megf10 UTSW 18 57289393 missense probably damaging 0.99
R3966:Megf10 UTSW 18 57180574 missense probably damaging 1.00
R4043:Megf10 UTSW 18 57259798 missense probably damaging 0.98
R4131:Megf10 UTSW 18 57180535 missense probably damaging 1.00
R4598:Megf10 UTSW 18 57189603 critical splice donor site probably null
R4598:Megf10 UTSW 18 57287812 missense probably damaging 1.00
R4726:Megf10 UTSW 18 57287792 missense probably benign 0.32
R4765:Megf10 UTSW 18 57287794 missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57293858 missense probably benign 0.00
R4928:Megf10 UTSW 18 57240673 missense probably benign
R5412:Megf10 UTSW 18 57191147 missense probably damaging 0.99
R5901:Megf10 UTSW 18 57277108 missense probably benign 0.11
R6015:Megf10 UTSW 18 57253028 missense probably benign 0.01
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6041:Megf10 UTSW 18 57180549 missense probably benign
R6369:Megf10 UTSW 18 57261187 missense probably benign 0.06
R6479:Megf10 UTSW 18 57246570 missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57291807 missense probably benign 0.01
R7228:Megf10 UTSW 18 57189589 missense probably damaging 1.00
R7296:Megf10 UTSW 18 57275753 missense probably damaging 1.00
R7437:Megf10 UTSW 18 57262131 missense probably damaging 1.00
R7461:Megf10 UTSW 18 57252853 missense probably damaging 0.98
R7488:Megf10 UTSW 18 57191115 missense probably damaging 0.99
R7492:Megf10 UTSW 18 57291794 missense probably benign 0.00
R7542:Megf10 UTSW 18 57189570 missense probably benign 0.07
R7636:Megf10 UTSW 18 57276989 missense possibly damaging 0.85
R7646:Megf10 UTSW 18 57293999 unclassified probably benign
R7650:Megf10 UTSW 18 57293999 unclassified probably benign
R7713:Megf10 UTSW 18 57293999 unclassified probably benign
R7714:Megf10 UTSW 18 57293999 unclassified probably benign
R7716:Megf10 UTSW 18 57293999 unclassified probably benign
R7796:Megf10 UTSW 18 57277659 missense possibly damaging 0.85
R7915:Megf10 UTSW 18 57240735 missense probably benign 0.05
R8221:Megf10 UTSW 18 57283821 missense probably benign 0.00
R8527:Megf10 UTSW 18 57292718 missense probably benign 0.00
R8559:Megf10 UTSW 18 57240627 missense probably damaging 1.00
R9117:Megf10 UTSW 18 57259701 missense probably damaging 1.00
R9337:Megf10 UTSW 18 57261180 nonsense probably null
R9481:Megf10 UTSW 18 57262018 missense probably benign 0.38
RF003:Megf10 UTSW 18 57294027 unclassified probably benign
Z1176:Megf10 UTSW 18 57277694 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGACATTTCCATCCACTCTG -3'
(R):5'- AATGGCTGTGTATGCCCAGTG -3'

Sequencing Primer
(F):5'- GACATTTCCATCCACTCTGATTAATG -3'
(R):5'- CAGCCACCAGTGCTACTTG -3'
Posted On 2022-09-12