Incidental Mutation 'R0765:Snai2'
ID72625
Institutional Source Beutler Lab
Gene Symbol Snai2
Ensembl Gene ENSMUSG00000022676
Gene Namesnail family zinc finger 2
SynonymsSnail2, Slug, Slugh
MMRRC Submission 038945-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R0765 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location14705852-14709385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14706804 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 58 (V58A)
Ref Sequence ENSEMBL: ENSMUSP00000023356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023356]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023356
AA Change: V58A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023356
Gene: ENSMUSG00000022676
AA Change: V58A

DomainStartEndE-ValueType
PDB:3W5K|B 1 59 4e-6 PDB
low complexity region 60 84 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
ZnF_C2H2 129 151 4.17e-3 SMART
ZnF_C2H2 160 182 6.88e-4 SMART
ZnF_C2H2 186 208 7.26e-3 SMART
ZnF_C2H2 214 236 9.88e-5 SMART
ZnF_C2H2 242 269 6.15e1 SMART
Meta Mutation Damage Score 0.1011 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Snail family of C2H2-type zinc finger transcription factors. The encoded protein acts as a transcriptional repressor that binds to E-box motifs and is also likely to repress E-cadherin transcription in breast carcinoma. This protein is involved in epithelial-mesenchymal transitions and has antiapoptotic activity. Mutations in this gene may be associated with sporatic cases of neural tube defects. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in growth retardation and eyelid deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T A 5: 107,506,934 D354E probably benign Het
Abhd16a T A 17: 35,101,851 V425D probably benign Het
Ano9 T G 7: 141,107,184 I381L probably damaging Het
Apob C T 12: 8,016,518 L4496F probably benign Het
Arhgef38 C T 3: 133,116,583 E724K probably damaging Het
Atp8b4 T A 2: 126,372,150 probably null Het
Baiap2l1 G T 5: 144,277,703 P394T probably damaging Het
Cnbp C A 6: 87,845,173 C122F probably damaging Het
Col3a1 A G 1: 45,336,651 probably benign Het
Colq T G 14: 31,526,037 D408A possibly damaging Het
Cuzd1 A T 7: 131,316,095 S259T probably benign Het
Cyp3a57 A G 5: 145,390,410 probably benign Het
Dbn1 C A 13: 55,482,294 V112F probably damaging Het
Dcc T A 18: 71,362,990 D1028V probably damaging Het
Dnajb11 T C 16: 22,862,568 V32A probably damaging Het
Dsg4 G A 18: 20,454,646 probably benign Het
Dyrk1b C T 7: 28,185,711 probably benign Het
Ebf1 T A 11: 44,869,160 M208K probably damaging Het
Efhc1 A G 1: 20,978,652 I430V probably benign Het
Elovl2 T C 13: 41,187,466 Y181C probably benign Het
Fras1 A G 5: 96,552,796 Q225R probably benign Het
Frmd3 G A 4: 74,161,767 R332Q probably damaging Het
Glg1 A G 8: 111,159,797 probably null Het
Hmcn1 G A 1: 150,808,787 T344M probably damaging Het
Il1rap T G 16: 26,710,632 probably null Het
Klra1 A T 6: 130,379,092 probably benign Het
Larp7 C A 3: 127,546,165 K289N probably damaging Het
Lgr6 C A 1: 134,993,886 G240V probably benign Het
Lrp10 G T 14: 54,468,090 D246Y probably damaging Het
Map3k20 G A 2: 72,371,925 V167I probably damaging Het
Med23 T C 10: 24,900,710 S347P probably damaging Het
Mybph T C 1: 134,197,496 V254A possibly damaging Het
Ndufv2 A G 17: 66,101,078 probably benign Het
Nuf2 A T 1: 169,522,936 probably benign Het
Nup210l T C 3: 90,119,877 Y189H probably damaging Het
Olfr1025-ps1 T C 2: 85,918,705 L260P probably damaging Het
Olfr1263 G A 2: 90,015,670 V247I probably benign Het
Olfr574 C T 7: 102,948,732 T79I probably damaging Het
Pdgfra C A 5: 75,187,987 probably benign Het
Phlpp1 T C 1: 106,392,283 L1336P probably damaging Het
Prpf38b T C 3: 108,911,418 T9A possibly damaging Het
Rnf213 G A 11: 119,423,095 probably null Het
Saal1 A T 7: 46,699,647 V281E possibly damaging Het
Slc17a3 C T 13: 23,846,896 Q186* probably null Het
Slc6a2 A G 8: 92,989,031 T266A probably damaging Het
Srfbp1 T C 18: 52,490,435 probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Tesk1 C T 4: 43,446,706 P365S possibly damaging Het
Tmem127 C A 2: 127,257,149 T201K probably damaging Het
Trim17 T G 11: 58,971,369 V409G possibly damaging Het
Trim43c C T 9: 88,841,916 T165I probably benign Het
Ush2a C A 1: 188,948,574 F4916L possibly damaging Het
Vmn1r89 A G 7: 13,219,540 M68V probably benign Het
Vmn2r105 C T 17: 20,227,711 E284K probably benign Het
Vmn2r105 T C 17: 20,227,857 D235G probably damaging Het
Vmn2r-ps134 C T 17: 23,446,041 noncoding transcript Het
Zdbf2 G A 1: 63,305,723 S1087N possibly damaging Het
Zfp534 G A 4: 147,674,236 P659S probably damaging Het
Other mutations in Snai2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Snai2 APN 16 14706771 missense probably benign 0.02
IGL03295:Snai2 APN 16 14706774 missense possibly damaging 0.64
IGL03412:Snai2 APN 16 14707256 missense possibly damaging 0.91
R0766:Snai2 UTSW 16 14708247 missense possibly damaging 0.71
R1419:Snai2 UTSW 16 14708180 missense possibly damaging 0.85
R1669:Snai2 UTSW 16 14707044 missense possibly damaging 0.95
R2096:Snai2 UTSW 16 14706997 missense possibly damaging 0.86
R2496:Snai2 UTSW 16 14706002 missense possibly damaging 0.86
R2901:Snai2 UTSW 16 14705983 missense possibly damaging 0.93
R4682:Snai2 UTSW 16 14708286 missense probably benign
R4832:Snai2 UTSW 16 14707017 missense probably damaging 0.97
R4879:Snai2 UTSW 16 14706741 missense probably benign
R5025:Snai2 UTSW 16 14708189 missense possibly damaging 0.95
R5794:Snai2 UTSW 16 14706726 missense probably benign
R6143:Snai2 UTSW 16 14708243 nonsense probably null
R6980:Snai2 UTSW 16 14708249 missense possibly damaging 0.92
R7096:Snai2 UTSW 16 14707164 missense possibly damaging 0.93
R7121:Snai2 UTSW 16 14707106 missense probably benign 0.00
R7501:Snai2 UTSW 16 14706890 missense possibly damaging 0.70
R8160:Snai2 UTSW 16 14706804 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCCCAGGTGAAGGGAAGACTTTATG -3'
(R):5'- CCTTGCCACAGATCTTGCAGACAC -3'

Sequencing Primer
(F):5'- CACTAGAGAGTCTCCTATGGAGTC -3'
(R):5'- AACGATTTCCTAGACTGGGC -3'
Posted On2013-09-30