Incidental Mutation 'R9260:Usp13'
ID 726264
Institutional Source Beutler Lab
Gene Symbol Usp13
Ensembl Gene ENSMUSG00000056900
Gene Name ubiquitin specific peptidase 13 (isopeptidase T-3)
Synonyms 2700071E21Rik, IsoT-3, ISOT3
MMRRC Submission 068962-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9260 (G1)
Quality Score 76.0075
Status Validated
Chromosome 3
Chromosomal Location 32871695-32992220 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to A at 32955909 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072312] [ENSMUST00000108228] [ENSMUST00000172481]
AlphaFold Q5BKP2
Predicted Effect probably benign
Transcript: ENSMUST00000072312
SMART Domains Protein: ENSMUSP00000072155
Gene: ENSMUSG00000056900

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 1e-17 BLAST
low complexity region 116 134 N/A INTRINSIC
ZnF_UBP 208 263 2.91e-20 SMART
low complexity region 625 639 N/A INTRINSIC
UBA 652 690 1.25e-6 SMART
UBA 724 761 1.19e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108228
SMART Domains Protein: ENSMUSP00000103863
Gene: ENSMUSG00000056900

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 1e-17 BLAST
low complexity region 115 133 N/A INTRINSIC
ZnF_UBP 207 262 2.91e-20 SMART
low complexity region 624 638 N/A INTRINSIC
UBA 651 689 1.25e-6 SMART
UBA 723 760 1.19e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172481
SMART Domains Protein: ENSMUSP00000133823
Gene: ENSMUSG00000056900

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:ZnF_UBP 46 91 9e-18 BLAST
low complexity region 116 134 N/A INTRINSIC
ZnF_UBP 208 263 2.91e-20 SMART
Pfam:UCH 333 523 5.1e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1a4 A G 1: 172,074,359 (GRCm39) I298T probably damaging Het
Bmper T A 9: 23,318,016 (GRCm39) L545H probably benign Het
Cacnb3 A G 15: 98,537,438 (GRCm39) S39G probably benign Het
Casr T C 16: 36,330,326 (GRCm39) K336R probably benign Het
Ccdc141 C A 2: 76,844,795 (GRCm39) G1424V probably damaging Het
Cd101 A T 3: 100,920,599 (GRCm39) D437E probably benign Het
Chadl A G 15: 81,578,058 (GRCm39) S524P probably damaging Het
Cimap2 T C 4: 106,472,634 (GRCm39) K84E probably benign Het
Clec4a4 C T 6: 123,000,895 (GRCm39) R203* probably null Het
Cntnap4 A G 8: 113,500,276 (GRCm39) I523V probably benign Het
Cpb1 T A 3: 20,316,638 (GRCm39) Y304F probably damaging Het
Dnajc14 T G 10: 128,642,766 (GRCm39) S229R possibly damaging Het
Dnajc15 A G 14: 78,081,839 (GRCm39) V101A possibly damaging Het
Dpyd A T 3: 119,108,447 (GRCm39) Y830F possibly damaging Het
Ehbp1l1 A G 19: 5,769,278 (GRCm39) V675A probably benign Het
F10 G A 8: 13,105,638 (GRCm39) C413Y probably damaging Het
Fam47e C T 5: 92,735,384 (GRCm39) L206F probably damaging Het
Fpr1 A T 17: 18,098,006 (GRCm39) probably benign Het
Frem2 G C 3: 53,560,204 (GRCm39) S1434R probably damaging Het
Gli3 G T 13: 15,899,675 (GRCm39) V1021F probably damaging Het
Gm7168 A T 17: 14,169,488 (GRCm39) N285I probably benign Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Herc1 T A 9: 66,325,691 (GRCm39) C1388* probably null Het
Hikeshi T C 7: 89,579,776 (GRCm39) probably benign Het
Hjv T A 3: 96,435,579 (GRCm39) I279N probably damaging Het
Igfn1 T C 1: 135,907,694 (GRCm39) E217G probably benign Het
Ighv1-59 T C 12: 115,298,737 (GRCm39) T106A probably benign Het
Igkv6-23 T A 6: 70,237,457 (GRCm39) I95F probably damaging Het
Il31ra A T 13: 112,668,202 (GRCm39) S456T probably damaging Het
Ints3 T C 3: 90,308,468 (GRCm39) D610G probably damaging Het
Iqcg G A 16: 32,855,973 (GRCm39) Q201* probably null Het
Kat14 T A 2: 144,235,441 (GRCm39) D300E probably benign Het
Kbtbd13 T C 9: 65,298,852 (GRCm39) H28R possibly damaging Het
Kcnh2 A T 5: 24,528,069 (GRCm39) D866E probably damaging Het
Kdm4b A G 17: 56,701,775 (GRCm39) T595A probably benign Het
Lct C T 1: 128,227,704 (GRCm39) W1263* probably null Het
Micall2 T A 5: 139,695,453 (GRCm39) M905L unknown Het
Mkrn1 T C 6: 39,382,530 (GRCm39) probably benign Het
Mobp A G 9: 119,997,572 (GRCm39) T164A unknown Het
Mtrr T C 13: 68,728,674 (GRCm39) E42G possibly damaging Het
Muc5b T A 7: 141,405,255 (GRCm39) W888R unknown Het
Myh7 G A 14: 55,224,842 (GRCm39) A575V probably damaging Het
Nbea A C 3: 55,891,233 (GRCm39) L1612W possibly damaging Het
Notch3 A G 17: 32,362,216 (GRCm39) probably null Het
Nsun4 T C 4: 115,902,007 (GRCm39) Y153C probably damaging Het
Nup210 A G 6: 91,039,785 (GRCm39) I690T probably benign Het
Nyap2 T A 1: 81,064,835 (GRCm39) probably benign Het
Oaz1 T A 10: 80,662,603 (GRCm39) S4T possibly damaging Het
Optn C T 2: 5,045,076 (GRCm39) C222Y probably benign Het
Or11i1 A G 3: 106,729,510 (GRCm39) S122P probably damaging Het
Or4f17-ps1 T A 2: 111,358,271 (GRCm39) V222E Het
Or5ac19 T C 16: 59,089,677 (GRCm39) M118V probably damaging Het
Or6c76b G A 10: 129,692,458 (GRCm39) V24M probably benign Het
Or7a40 A T 16: 16,491,337 (GRCm39) C169* probably null Het
Osmr T A 15: 6,882,033 (GRCm39) H37L probably benign Het
Pccb G T 9: 100,877,643 (GRCm39) P287Q probably benign Het
Pclo T A 5: 14,764,287 (GRCm39) D4253E unknown Het
Pdcd6ip A T 9: 113,526,572 (GRCm39) probably null Het
Pde9a T C 17: 31,678,137 (GRCm39) probably null Het
Pdk2 C A 11: 94,930,260 (GRCm39) V59F probably damaging Het
Pgm1 T A 4: 99,827,186 (GRCm39) V362E probably damaging Het
Pmepa1 CCGGCGGCGGCGGCGGCGG CCGGCGGCGGCGGCGG 2: 173,117,943 (GRCm39) probably benign Het
Pold4 T C 19: 4,282,904 (GRCm39) F97S possibly damaging Het
Ppp5c C T 7: 16,740,886 (GRCm39) V361I probably benign Het
Prrt1 A G 17: 34,850,120 (GRCm39) Y178C probably damaging Het
Psmb11 A T 14: 54,863,033 (GRCm39) I84F probably damaging Het
Smg7 A G 1: 152,737,549 (GRCm39) S131P probably damaging Het
Snrnp200 T A 2: 127,078,428 (GRCm39) L1728Q probably damaging Het
Stbd1 A T 5: 92,753,456 (GRCm39) E315D probably damaging Het
Tcaf1 C T 6: 42,663,554 (GRCm39) G109R possibly damaging Het
Thap12 C T 7: 98,356,280 (GRCm39) R56* probably null Het
Ttn T C 2: 76,645,919 (GRCm39) E12848G probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Uqcrfs1 G A 13: 30,725,108 (GRCm39) A144V probably damaging Het
Wdr19 T A 5: 65,363,789 (GRCm39) D67E possibly damaging Het
Zfp998 A T 13: 66,579,375 (GRCm39) H369Q unknown Het
Zkscan3 A T 13: 21,578,210 (GRCm39) W226R probably damaging Het
Zmym5 A C 14: 57,041,641 (GRCm39) F154C probably damaging Het
Other mutations in Usp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Usp13 APN 3 32,935,560 (GRCm39) missense probably damaging 0.98
IGL00949:Usp13 APN 3 32,940,726 (GRCm39) missense possibly damaging 0.57
IGL01637:Usp13 APN 3 32,973,213 (GRCm39) missense probably benign 0.02
IGL01983:Usp13 APN 3 32,971,608 (GRCm39) missense probably damaging 1.00
IGL02002:Usp13 APN 3 32,901,974 (GRCm39) missense probably damaging 0.97
IGL02065:Usp13 APN 3 32,987,314 (GRCm39) missense probably damaging 1.00
IGL02390:Usp13 APN 3 32,985,865 (GRCm39) nonsense probably null
IGL02399:Usp13 APN 3 32,973,209 (GRCm39) missense probably damaging 1.00
IGL02535:Usp13 APN 3 32,892,075 (GRCm39) missense probably benign 0.43
IGL02863:Usp13 APN 3 32,973,096 (GRCm39) missense possibly damaging 0.95
IGL03017:Usp13 APN 3 32,969,861 (GRCm39) missense possibly damaging 0.90
IGL03242:Usp13 APN 3 32,956,218 (GRCm39) missense probably benign 0.17
PIT4504001:Usp13 UTSW 3 32,959,579 (GRCm39) missense probably damaging 1.00
R0113:Usp13 UTSW 3 32,872,025 (GRCm39) splice site probably benign
R0233:Usp13 UTSW 3 32,969,813 (GRCm39) splice site probably null
R0233:Usp13 UTSW 3 32,969,813 (GRCm39) splice site probably null
R1241:Usp13 UTSW 3 32,969,857 (GRCm39) missense probably damaging 1.00
R1765:Usp13 UTSW 3 32,969,919 (GRCm39) missense probably benign 0.01
R2105:Usp13 UTSW 3 32,956,135 (GRCm39) missense probably damaging 0.97
R2229:Usp13 UTSW 3 32,971,700 (GRCm39) missense probably benign 0.02
R2381:Usp13 UTSW 3 32,935,658 (GRCm39) critical splice donor site probably null
R2389:Usp13 UTSW 3 32,959,613 (GRCm39) missense probably benign 0.16
R3801:Usp13 UTSW 3 32,935,657 (GRCm39) missense possibly damaging 0.75
R4062:Usp13 UTSW 3 32,935,572 (GRCm39) missense probably damaging 1.00
R4653:Usp13 UTSW 3 32,892,073 (GRCm39) missense probably damaging 0.99
R5123:Usp13 UTSW 3 32,969,947 (GRCm39) missense probably benign 0.03
R5454:Usp13 UTSW 3 32,959,585 (GRCm39) missense probably damaging 1.00
R5527:Usp13 UTSW 3 32,919,987 (GRCm39) missense probably damaging 1.00
R5582:Usp13 UTSW 3 32,965,738 (GRCm39) missense probably damaging 1.00
R5589:Usp13 UTSW 3 32,892,007 (GRCm39) missense probably damaging 1.00
R5829:Usp13 UTSW 3 32,940,672 (GRCm39) missense possibly damaging 0.68
R6114:Usp13 UTSW 3 32,908,818 (GRCm39) missense probably damaging 1.00
R6625:Usp13 UTSW 3 32,949,025 (GRCm39) missense probably damaging 0.98
R6680:Usp13 UTSW 3 32,935,618 (GRCm39) missense probably damaging 0.98
R7175:Usp13 UTSW 3 32,971,757 (GRCm39) nonsense probably null
R7232:Usp13 UTSW 3 32,920,020 (GRCm39) missense probably benign 0.05
R7242:Usp13 UTSW 3 32,919,892 (GRCm39) splice site probably null
R7263:Usp13 UTSW 3 32,949,000 (GRCm39) missense probably damaging 1.00
R7533:Usp13 UTSW 3 32,973,091 (GRCm39) missense probably damaging 0.99
R7716:Usp13 UTSW 3 32,892,005 (GRCm39) nonsense probably null
R7734:Usp13 UTSW 3 32,892,054 (GRCm39) missense probably benign 0.13
R7943:Usp13 UTSW 3 32,931,089 (GRCm39) missense probably damaging 1.00
R8075:Usp13 UTSW 3 32,985,852 (GRCm39) missense probably damaging 1.00
R8141:Usp13 UTSW 3 32,949,025 (GRCm39) missense possibly damaging 0.52
R8259:Usp13 UTSW 3 32,971,748 (GRCm39) nonsense probably null
R8722:Usp13 UTSW 3 32,956,114 (GRCm39) missense probably benign 0.00
R8905:Usp13 UTSW 3 32,935,572 (GRCm39) missense probably damaging 1.00
R9060:Usp13 UTSW 3 32,965,812 (GRCm39) critical splice donor site probably null
R9081:Usp13 UTSW 3 32,935,542 (GRCm39) missense probably benign 0.00
R9576:Usp13 UTSW 3 32,969,135 (GRCm39) critical splice acceptor site probably null
X0064:Usp13 UTSW 3 32,940,738 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTTGGAAGGATGTTACCATATCC -3'
(R):5'- GAGCCAATGCGATTCCTCTG -3'

Sequencing Primer
(F):5'- TGGTTTTCCCAGGACAGT -3'
(R):5'- AATGCGATTCCTCTGAAGGTC -3'
Posted On 2022-09-14