Incidental Mutation 'R9264:Mslnl'
ID 726282
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Name mesothelin-like
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9264 (G1)
Quality Score 151.008
Status Validated
Chromosome 17
Chromosomal Location 25955016-25967304 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to G at 25961506 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
AlphaFold Q8C160
Predicted Effect probably benign
Transcript: ENSMUST00000047098
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,001,056 (GRCm39) I1531L probably benign Het
Adam28 T C 14: 68,844,914 (GRCm39) Y791C probably benign Het
Ankrd40 T A 11: 94,229,187 (GRCm39) I262N probably damaging Het
Catsperg2 A T 7: 29,397,613 (GRCm39) N1033K possibly damaging Het
Cdh10 A T 15: 18,964,081 (GRCm39) D81V probably damaging Het
Cep290 T C 10: 100,333,878 (GRCm39) V310A possibly damaging Het
Cep78 T C 19: 15,951,830 (GRCm39) Y325C probably damaging Het
Clstn3 T A 6: 124,436,727 (GRCm39) D197V probably damaging Het
Col11a1 T C 3: 114,005,809 (GRCm39) I1647T unknown Het
Col5a1 G A 2: 27,854,123 (GRCm39) R569K unknown Het
Cspg4b G A 13: 113,456,014 (GRCm39) V687M Het
Cyp4a10 T C 4: 115,381,475 (GRCm39) S180P probably benign Het
D630045J12Rik T C 6: 38,135,173 (GRCm39) I1336V probably benign Het
Dchs2 G A 3: 83,177,784 (GRCm39) V946M probably damaging Het
Dnah10 A G 5: 124,813,900 (GRCm39) R347G probably damaging Het
Dnah11 T A 12: 117,991,262 (GRCm39) D2368V probably damaging Het
Ganab T C 19: 8,890,228 (GRCm39) I719T possibly damaging Het
Gm10944 C A 10: 10,557,583 (GRCm39) A11D unknown Het
Gmcl1 T C 6: 86,691,195 (GRCm39) M267V probably benign Het
Inhbe T A 10: 127,186,427 (GRCm39) D251V probably damaging Het
Kcnj1 G A 9: 32,307,654 (GRCm39) R26Q probably benign Het
Lama5 A G 2: 179,838,271 (GRCm39) probably benign Het
Lin9 T A 1: 180,494,912 (GRCm39) D251E probably damaging Het
Magel2 T A 7: 62,028,344 (GRCm39) I416N possibly damaging Het
Mdga2 T C 12: 66,560,057 (GRCm39) N772S probably damaging Het
Ms4a20 T A 19: 11,093,830 (GRCm39) M1L probably benign Het
Msh3 G T 13: 92,485,812 (GRCm39) Q171K probably benign Het
Mtpn A G 6: 35,489,176 (GRCm39) L116P possibly damaging Het
Myh7 T C 14: 55,213,454 (GRCm39) T1351A probably benign Het
Nectin3 A T 16: 46,274,998 (GRCm39) I353N probably damaging Het
Nprl3 A T 11: 32,183,948 (GRCm39) N500K probably benign Het
Nup93 T A 8: 95,019,348 (GRCm39) I181N probably benign Het
Optc T C 1: 133,832,978 (GRCm39) I41V probably benign Het
Or1b1 G A 2: 36,994,801 (GRCm39) T287I probably damaging Het
Or4p23 T C 2: 88,576,776 (GRCm39) H152R probably damaging Het
Pcdh7 C A 5: 58,286,663 (GRCm39) N1246K probably benign Het
Pcdhb3 T A 18: 37,435,166 (GRCm39) D377E probably benign Het
Pnpla6 C T 8: 3,573,294 (GRCm39) P386L probably benign Het
Polr3a T C 14: 24,520,899 (GRCm39) T587A probably benign Het
Pramel1 T G 4: 143,125,099 (GRCm39) L341R probably damaging Het
Rhot2 A T 17: 26,060,740 (GRCm39) N210K probably damaging Het
Slc37a1 A G 17: 31,519,459 (GRCm39) I12V probably benign Het
Spmip7 T A 11: 11,414,678 (GRCm39) D141E Het
Sstr3 G T 15: 78,423,792 (GRCm39) N318K probably damaging Het
Ssx2ip T C 3: 146,142,955 (GRCm39) V511A probably benign Het
Stfa1 G A 16: 36,100,930 (GRCm39) V57I unknown Het
Syne1 T G 10: 5,212,793 (GRCm39) R3265S probably damaging Het
Tacc2 G T 7: 130,228,533 (GRCm39) K1739N probably damaging Het
Tas2r143 A T 6: 42,377,673 (GRCm39) M168L probably benign Het
Tm4sf1 A T 3: 57,202,031 (GRCm39) probably null Het
Ttc16 A G 2: 32,653,017 (GRCm39) I604T possibly damaging Het
Ugt1a10 T A 1: 87,983,393 (GRCm39) W64R possibly damaging Het
Usp34 A T 11: 23,439,064 (GRCm39) H3561L Het
Vasp C T 7: 18,993,376 (GRCm39) V276I unknown Het
Vwa3a A G 7: 120,374,687 (GRCm39) N333S probably benign Het
Wipf3 A G 6: 54,460,866 (GRCm39) N105D probably benign Het
Zfp760 T C 17: 21,942,663 (GRCm39) S613P possibly damaging Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25,962,641 (GRCm39) unclassified probably benign
IGL01629:Mslnl APN 17 25,963,749 (GRCm39) missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25,965,125 (GRCm39) missense probably benign 0.07
IGL02408:Mslnl APN 17 25,966,972 (GRCm39) missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25,963,077 (GRCm39) critical splice donor site probably null
IGL03387:Mslnl APN 17 25,963,051 (GRCm39) missense probably benign 0.06
R0561:Mslnl UTSW 17 25,962,177 (GRCm39) nonsense probably null
R0881:Mslnl UTSW 17 25,961,939 (GRCm39) missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1296:Mslnl UTSW 17 25,962,214 (GRCm39) missense probably damaging 1.00
R1582:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1629:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1630:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1631:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1632:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1794:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1850:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1866:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1876:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R1914:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2166:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2241:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2243:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2247:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2282:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2284:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2852:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2867:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2877:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2878:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2919:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R2920:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3026:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3405:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3406:Mslnl UTSW 17 25,965,155 (GRCm39) missense probably damaging 1.00
R3411:Mslnl UTSW 17 25,963,491 (GRCm39) missense probably benign 0.05
R3434:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3546:Mslnl UTSW 17 25,963,943 (GRCm39) missense probably damaging 0.98
R3612:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3729:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3730:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3802:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3804:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3894:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R3895:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4454:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4455:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4456:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4457:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4561:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4562:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4564:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4600:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4601:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4610:Mslnl UTSW 17 25,961,908 (GRCm39) missense probably damaging 0.97
R4704:Mslnl UTSW 17 25,957,952 (GRCm39) missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25,957,942 (GRCm39) nonsense probably null
R5257:Mslnl UTSW 17 25,965,139 (GRCm39) missense probably benign 0.00
R5456:Mslnl UTSW 17 25,962,133 (GRCm39) missense probably damaging 0.98
R5645:Mslnl UTSW 17 25,956,816 (GRCm39) missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25,965,749 (GRCm39) missense probably benign 0.00
R6083:Mslnl UTSW 17 25,956,876 (GRCm39) missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25,963,531 (GRCm39) missense probably damaging 1.00
R6761:Mslnl UTSW 17 25,965,047 (GRCm39) missense probably damaging 1.00
R7058:Mslnl UTSW 17 25,962,186 (GRCm39) missense probably benign 0.03
R7156:Mslnl UTSW 17 25,962,184 (GRCm39) missense probably benign 0.20
R7467:Mslnl UTSW 17 25,955,895 (GRCm39) start codon destroyed probably benign 0.33
R7687:Mslnl UTSW 17 25,962,157 (GRCm39) missense probably damaging 0.97
R7807:Mslnl UTSW 17 25,965,751 (GRCm39) missense probably benign 0.03
R8682:Mslnl UTSW 17 25,965,962 (GRCm39) missense probably benign
R8735:Mslnl UTSW 17 25,964,062 (GRCm39) missense probably benign 0.09
R8742:Mslnl UTSW 17 25,964,047 (GRCm39) missense probably damaging 1.00
R9208:Mslnl UTSW 17 25,961,694 (GRCm39) missense possibly damaging 0.94
RF007:Mslnl UTSW 17 25,962,202 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CACAGTTGAACAGCTGCAGC -3'
(R):5'- TCGAAGTCATCCTGGAGACC -3'

Sequencing Primer
(F):5'- ACAAAGATCCCCTGTGTGTG -3'
(R):5'- TGGAGACCCAGCTGTGCAG -3'
Posted On 2022-09-14