Incidental Mutation 'R9264:Mslnl'
ID 726282
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Name mesothelin-like
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9264 (G1)
Quality Score 151.008
Status Validated
Chromosome 17
Chromosomal Location 25736040-25748330 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to G at 25742532 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098]
AlphaFold Q8C160
Predicted Effect probably benign
Transcript: ENSMUST00000047098
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,116,466 M1L probably benign Het
Abca15 A T 7: 120,401,833 I1531L probably benign Het
Adam28 T C 14: 68,607,465 Y791C probably benign Het
Ankrd40 T A 11: 94,338,361 I262N probably damaging Het
BC067074 G A 13: 113,319,480 V687M Het
Catsperg2 A T 7: 29,698,188 N1033K possibly damaging Het
Cdh10 A T 15: 18,963,995 D81V probably damaging Het
Cep290 T C 10: 100,498,016 V310A possibly damaging Het
Cep78 T C 19: 15,974,466 Y325C probably damaging Het
Clstn3 T A 6: 124,459,768 D197V probably damaging Het
Col11a1 T C 3: 114,212,160 I1647T unknown Het
Col5a1 G A 2: 27,964,111 R569K unknown Het
Cyp4a10 T C 4: 115,524,278 S180P probably benign Het
D630045J12Rik T C 6: 38,158,238 I1336V probably benign Het
Dchs2 G A 3: 83,270,477 V946M probably damaging Het
Dnah10 A G 5: 124,736,836 R347G probably damaging Het
Dnah11 T A 12: 118,027,527 D2368V probably damaging Het
Ganab T C 19: 8,912,864 I719T possibly damaging Het
Gm10944 C A 10: 10,681,839 A11D unknown Het
Gmcl1 T C 6: 86,714,213 M267V probably benign Het
Inhbe T A 10: 127,350,558 D251V probably damaging Het
Kcnj1 G A 9: 32,396,358 R26Q probably benign Het
Lama5 A G 2: 180,196,478 probably benign Het
Lin9 T A 1: 180,667,347 D251E probably damaging Het
Magel2 T A 7: 62,378,596 I416N possibly damaging Het
Mdga2 T C 12: 66,513,283 N772S probably damaging Het
Msh3 G T 13: 92,349,304 Q171K probably benign Het
Mtpn A G 6: 35,512,241 L116P possibly damaging Het
Myh7 T C 14: 54,975,997 T1351A probably benign Het
Nectin3 A T 16: 46,454,635 I353N probably damaging Het
Nprl3 A T 11: 32,233,948 N500K probably benign Het
Nup93 T A 8: 94,292,720 I181N probably benign Het
Olfr1198 T C 2: 88,746,432 H152R probably damaging Het
Olfr362 G A 2: 37,104,789 T287I probably damaging Het
Optc T C 1: 133,905,240 I41V probably benign Het
Pcdh7 C A 5: 58,129,321 N1246K probably benign Het
Pcdhb3 T A 18: 37,302,113 D377E probably benign Het
Pnpla6 C T 8: 3,523,294 P386L probably benign Het
Polr3a T C 14: 24,470,831 T587A probably benign Het
Pramel1 T G 4: 143,398,529 L341R probably damaging Het
Rhot2 A T 17: 25,841,766 N210K probably damaging Het
Slc37a1 A G 17: 31,300,485 I12V probably benign Het
Spata48 T A 11: 11,464,678 D141E Het
Sstr3 G T 15: 78,539,592 N318K probably damaging Het
Ssx2ip T C 3: 146,437,200 V511A probably benign Het
Stfa1 G A 16: 36,280,568 V57I unknown Het
Syne1 T G 10: 5,262,793 R3265S probably damaging Het
Tacc2 G T 7: 130,626,803 K1739N probably damaging Het
Tas2r143 A T 6: 42,400,739 M168L probably benign Het
Tm4sf1 A T 3: 57,294,610 probably null Het
Ttc16 A G 2: 32,763,005 I604T possibly damaging Het
Ugt1a10 T A 1: 88,055,671 W64R possibly damaging Het
Usp34 A T 11: 23,489,064 H3561L Het
Vasp C T 7: 19,259,451 V276I unknown Het
Vwa3a A G 7: 120,775,464 N333S probably benign Het
Wipf3 A G 6: 54,483,881 N105D probably benign Het
Zfp760 T C 17: 21,723,682 S613P possibly damaging Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25743667 unclassified probably benign
IGL01629:Mslnl APN 17 25744775 missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25746151 missense probably benign 0.07
IGL02408:Mslnl APN 17 25747998 missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25744103 critical splice donor site probably null
IGL03387:Mslnl APN 17 25744077 missense probably benign 0.06
R0561:Mslnl UTSW 17 25743203 nonsense probably null
R0881:Mslnl UTSW 17 25742965 missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1296:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1582:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1629:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1630:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1631:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1632:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1794:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1850:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1866:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1876:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1914:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2166:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2241:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2243:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2247:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2282:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2284:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2852:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2877:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2878:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2919:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2920:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3026:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3405:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3406:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3411:Mslnl UTSW 17 25744517 missense probably benign 0.05
R3434:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3546:Mslnl UTSW 17 25744969 missense probably damaging 0.98
R3612:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3729:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3730:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3802:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3804:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3894:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3895:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4454:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4455:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4456:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4457:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4561:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4562:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4564:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4600:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4601:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4610:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4704:Mslnl UTSW 17 25738978 missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25738968 nonsense probably null
R5257:Mslnl UTSW 17 25746165 missense probably benign 0.00
R5456:Mslnl UTSW 17 25743159 missense probably damaging 0.98
R5645:Mslnl UTSW 17 25737842 missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25746775 missense probably benign 0.00
R6083:Mslnl UTSW 17 25737902 missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25744557 missense probably damaging 1.00
R6761:Mslnl UTSW 17 25746073 missense probably damaging 1.00
R7058:Mslnl UTSW 17 25743212 missense probably benign 0.03
R7156:Mslnl UTSW 17 25743210 missense probably benign 0.20
R7467:Mslnl UTSW 17 25736921 start codon destroyed probably benign 0.33
R7687:Mslnl UTSW 17 25743183 missense probably damaging 0.97
R7807:Mslnl UTSW 17 25746777 missense probably benign 0.03
R8682:Mslnl UTSW 17 25746988 missense probably benign
R8735:Mslnl UTSW 17 25745088 missense probably benign 0.09
R8742:Mslnl UTSW 17 25745073 missense probably damaging 1.00
R9208:Mslnl UTSW 17 25742720 missense possibly damaging 0.94
RF007:Mslnl UTSW 17 25743228 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CACAGTTGAACAGCTGCAGC -3'
(R):5'- TCGAAGTCATCCTGGAGACC -3'

Sequencing Primer
(F):5'- ACAAAGATCCCCTGTGTGTG -3'
(R):5'- TGGAGACCCAGCTGTGCAG -3'
Posted On 2022-09-14