Incidental Mutation 'R9127:Cfap65'
ID 726308
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock # R9127 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74902071-74935599 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 74919351 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik A T 10: 82,622,754 M21K probably benign Het
1700014D04Rik A G 13: 59,743,014 S331P probably benign Het
1700029J07Rik T G 8: 45,962,366 D201A probably benign Het
Abca13 T G 11: 9,292,080 D1314E probably benign Het
Abcb1a A T 5: 8,674,707 R47W probably benign Het
Abcc6 T C 7: 45,979,760 N1354S probably damaging Het
Abracl T C 10: 18,011,696 Y61C probably damaging Het
Adamtsl1 A G 4: 86,289,790 T633A probably benign Het
Agap3 G A 5: 24,476,441 probably benign Het
Ago4 A T 4: 126,507,111 M647K probably damaging Het
Akap7 G T 10: 25,279,778 S72R unknown Het
Arhgef12 A G 9: 42,974,574 L1251S possibly damaging Het
Astn2 A T 4: 66,403,927 V145E unknown Het
Atxn2l A T 7: 126,498,221 S304R probably damaging Het
Cd226 A T 18: 89,269,031 I318F probably damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Chtf8 A G 8: 106,887,008 V18A probably benign Het
Cit G T 5: 115,936,837 E683* probably null Het
Ckmt2 T C 13: 91,859,218 R286G probably damaging Het
Clec4a2 T A 6: 123,139,259 W128R probably damaging Het
Clec4n T G 6: 123,235,488 S88A probably damaging Het
Cndp2 G A 18: 84,680,996 A48V probably benign Het
Csmd1 T C 8: 16,223,272 T849A probably benign Het
Cts3 A T 13: 61,567,421 Y199* probably null Het
Dag1 A T 9: 108,208,535 L469* probably null Het
Dclre1c T C 2: 3,438,088 V225A Het
Dedd A G 1: 171,338,841 D115G probably damaging Het
E330014E10Rik A G 5: 95,803,764 Y470C probably damaging Het
Eif2ak3 T A 6: 70,883,720 W427R probably damaging Het
Fbln2 T A 6: 91,233,491 V139D probably damaging Het
Fbn1 A T 2: 125,382,065 M588K possibly damaging Het
Gm11639 T A 11: 104,850,581 V2166D probably benign Het
Gm17019 A T 5: 15,031,099 Y109* probably null Het
Gm32742 T A 9: 51,144,715 N1255Y probably damaging Het
Gm5431 T A 11: 48,888,773 K441* probably null Het
Golga2 A G 2: 32,306,067 D898G Het
Gramd4 G A 15: 86,091,324 R39H probably benign Het
Gucy1a2 A G 9: 3,634,553 N199S probably damaging Het
Heyl G A 4: 123,246,092 R148H probably damaging Het
Ifi208 A T 1: 173,695,834 M557L probably benign Het
Igf2r A G 17: 12,739,351 V145A probably damaging Het
Ighv1-4 A T 12: 114,487,259 Y76* probably null Het
Ikzf4 T C 10: 128,632,618 D664G unknown Het
Il1a T A 2: 129,304,795 Y126F possibly damaging Het
Lmf2 C A 15: 89,355,568 probably benign Het
Lyst T C 13: 13,634,242 S166P probably damaging Het
Mgat5 A C 1: 127,366,460 T180P probably benign Het
Mical2 A C 7: 112,271,382 K26T possibly damaging Het
Mov10 G T 3: 104,804,343 Y209* probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Numa1 T A 7: 101,992,662 S106T possibly damaging Het
Olfr1232 G A 2: 89,326,130 Q17* probably null Het
Olfr1461 A G 19: 13,165,032 N6S probably damaging Het
Olfr396-ps1 A T 11: 73,928,341 E39V probably damaging Het
Olfr845 A G 9: 19,338,730 H90R probably benign Het
Pcdhb14 A G 18: 37,449,038 N399S probably damaging Het
Plcl2 T A 17: 50,611,004 S944T probably benign Het
Pml A T 9: 58,220,377 I695N probably benign Het
Ppard G T 17: 28,286,375 R12L unknown Het
Ppip5k1 C T 2: 121,327,644 probably null Het
Ppp1r3g T C 13: 35,968,638 S14P probably benign Het
Prrc2b C A 2: 32,213,752 R1081S probably damaging Het
Rasgrp2 A T 19: 6,404,408 E160D possibly damaging Het
Rb1cc1 G A 1: 6,262,849 V1331I probably damaging Het
Rnd3 A T 2: 51,132,401 S210T probably benign Het
Scaf11 T C 15: 96,414,883 T1426A probably benign Het
Sin3b C T 8: 72,733,406 T207I possibly damaging Het
Slc26a7 A T 4: 14,593,873 Y81N probably damaging Het
Slc28a3 C T 13: 58,576,767 M224I probably benign Het
Slc30a1 T C 1: 191,907,230 I75T probably damaging Het
Slc6a21 T A 7: 45,280,250 probably benign Het
Slco2a1 T A 9: 103,068,044 L206Q probably damaging Het
Sptbn1 A G 11: 30,154,356 V116A probably damaging Het
Syngap1 G A 17: 26,962,121 D1008N probably damaging Het
Syt11 T C 3: 88,762,336 D83G probably benign Het
Syt14 G A 1: 192,901,823 T428I probably damaging Het
Taf15 T A 11: 83,504,259 Y338* probably null Het
Tfap4 A T 16: 4,547,319 M253K possibly damaging Het
Tnr T C 1: 159,886,110 S703P possibly damaging Het
Trrap G A 5: 144,831,020 D2577N probably benign Het
Wdr20 C T 12: 110,793,163 S161L possibly damaging Het
Zfp503 C A 14: 21,987,350 V62L probably benign Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
R8996:Cfap65 UTSW 1 74902188 missense probably benign 0.11
R9020:Cfap65 UTSW 1 74920393 missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74904688 missense possibly damaging 0.88
R9187:Cfap65 UTSW 1 74917358 missense probably benign 0.00
R9210:Cfap65 UTSW 1 74920408 missense probably benign
R9212:Cfap65 UTSW 1 74920408 missense probably benign
R9273:Cfap65 UTSW 1 74921610 missense probably benign 0.00
R9454:Cfap65 UTSW 1 74905051 missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74906309 critical splice donor site probably null
R9595:Cfap65 UTSW 1 74907378 missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74919342 missense probably benign 0.16
R9742:Cfap65 UTSW 1 74904681 missense probably benign 0.08
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGAGAGGCATCCAGTAAC -3'
(R):5'- AGTTCACTTTTCTGAGGCTCCAG -3'

Sequencing Primer
(F):5'- GAGGCATCCAGTAACACCCATG -3'
(R):5'- GAGGCTCCAGTTTCCATCATAATGAG -3'
Posted On 2022-09-30