Incidental Mutation 'R9127:Cfap65'
ID 726308
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 068926-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.676) question?
Stock # R9127 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74902071-74935599 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 74919351 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik A T 10: 82,622,754 M21K probably benign Het
1700014D04Rik A G 13: 59,743,014 S331P probably benign Het
1700029J07Rik T G 8: 45,962,366 D201A probably benign Het
Abca13 T G 11: 9,292,080 D1314E probably benign Het
Abcb1a A T 5: 8,674,707 R47W probably benign Het
Abcc6 T C 7: 45,979,760 N1354S probably damaging Het
Abracl T C 10: 18,011,696 Y61C probably damaging Het
Adamtsl1 A G 4: 86,289,790 T633A probably benign Het
Agap3 G A 5: 24,476,441 probably benign Het
Ago4 A T 4: 126,507,111 M647K probably damaging Het
Akap7 G T 10: 25,279,778 S72R unknown Het
Arhgef12 A G 9: 42,974,574 L1251S possibly damaging Het
Astn2 A T 4: 66,403,927 V145E unknown Het
Atxn2l A T 7: 126,498,221 S304R probably damaging Het
Cd226 A T 18: 89,269,031 I318F probably damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Chtf8 A G 8: 106,887,008 V18A probably benign Het
Cit G T 5: 115,936,837 E683* probably null Het
Ckmt2 T C 13: 91,859,218 R286G probably damaging Het
Clec4a2 T A 6: 123,139,259 W128R probably damaging Het
Clec4n T G 6: 123,235,488 S88A probably damaging Het
Cndp2 G A 18: 84,680,996 A48V probably benign Het
Csmd1 T C 8: 16,223,272 T849A probably benign Het
Cts3 A T 13: 61,567,421 Y199* probably null Het
Dag1 A T 9: 108,208,535 L469* probably null Het
Dclre1c T C 2: 3,438,088 V225A Het
Dedd A G 1: 171,338,841 D115G probably damaging Het
E330014E10Rik A G 5: 95,803,764 Y470C probably damaging Het
Eif2ak3 T A 6: 70,883,720 W427R probably damaging Het
Fbln2 T A 6: 91,233,491 V139D probably damaging Het
Fbn1 A T 2: 125,382,065 M588K possibly damaging Het
Gm11639 T A 11: 104,850,581 V2166D probably benign Het
Gm17019 A T 5: 15,031,099 Y109* probably null Het
Gm32742 T A 9: 51,144,715 N1255Y probably damaging Het
Gm5431 T A 11: 48,888,773 K441* probably null Het
Golga2 A G 2: 32,306,067 D898G Het
Gramd4 G A 15: 86,091,324 R39H probably benign Het
Gucy1a2 A G 9: 3,634,553 N199S probably damaging Het
Heyl G A 4: 123,246,092 R148H probably damaging Het
Ifi208 A T 1: 173,695,834 M557L probably benign Het
Igf2r A G 17: 12,739,351 V145A probably damaging Het
Ighv1-4 A T 12: 114,487,259 Y76* probably null Het
Ikzf4 T C 10: 128,632,618 D664G unknown Het
Il1a T A 2: 129,304,795 Y126F possibly damaging Het
Lmf2 C A 15: 89,355,568 probably benign Het
Lyst T C 13: 13,634,242 S166P probably damaging Het
Mgat5 A C 1: 127,366,460 T180P probably benign Het
Mical2 A C 7: 112,271,382 K26T possibly damaging Het
Mov10 G T 3: 104,804,343 Y209* probably null Het
Nol8 T C 13: 49,661,999 Y528H probably benign Het
Numa1 T A 7: 101,992,662 S106T possibly damaging Het
Olfr1232 G A 2: 89,326,130 Q17* probably null Het
Olfr1461 A G 19: 13,165,032 N6S probably damaging Het
Olfr396-ps1 A T 11: 73,928,341 E39V probably damaging Het
Olfr845 A G 9: 19,338,730 H90R probably benign Het
Pcdhb14 A G 18: 37,449,038 N399S probably damaging Het
Plcl2 T A 17: 50,611,004 S944T probably benign Het
Pml A T 9: 58,220,377 I695N probably benign Het
Ppard G T 17: 28,286,375 R12L unknown Het
Ppip5k1 C T 2: 121,327,644 probably null Het
Ppp1r3g T C 13: 35,968,638 S14P probably benign Het
Prrc2b C A 2: 32,213,752 R1081S probably damaging Het
Rasgrp2 A T 19: 6,404,408 E160D possibly damaging Het
Rb1cc1 G A 1: 6,262,849 V1331I probably damaging Het
Rnd3 A T 2: 51,132,401 S210T probably benign Het
Scaf11 T C 15: 96,414,883 T1426A probably benign Het
Sin3b C T 8: 72,733,406 T207I possibly damaging Het
Slc26a7 A T 4: 14,593,873 Y81N probably damaging Het
Slc28a3 C T 13: 58,576,767 M224I probably benign Het
Slc30a1 T C 1: 191,907,230 I75T probably damaging Het
Slc6a21 T A 7: 45,280,250 probably benign Het
Slco2a1 T A 9: 103,068,044 L206Q probably damaging Het
Sptbn1 A G 11: 30,154,356 V116A probably damaging Het
Syngap1 G A 17: 26,962,121 D1008N probably damaging Het
Syt11 T C 3: 88,762,336 D83G probably benign Het
Syt14 G A 1: 192,901,823 T428I probably damaging Het
Taf15 T A 11: 83,504,259 Y338* probably null Het
Tfap4 A T 16: 4,547,319 M253K possibly damaging Het
Tnr T C 1: 159,886,110 S703P possibly damaging Het
Trrap G A 5: 144,831,020 D2577N probably benign Het
Wdr20 C T 12: 110,793,163 S161L possibly damaging Het
Zfp503 C A 14: 21,987,350 V62L probably benign Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,919,183 (GRCm38) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,911,078 (GRCm38) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,927,194 (GRCm38) missense probably benign
IGL01780:Cfap65 APN 1 74,928,348 (GRCm38) nonsense probably null
IGL01993:Cfap65 APN 1 74,920,543 (GRCm38) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,928,145 (GRCm38) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,928,348 (GRCm38) nonsense probably null
IGL02357:Cfap65 APN 1 74,928,348 (GRCm38) nonsense probably null
IGL02576:Cfap65 APN 1 74,903,458 (GRCm38) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,905,080 (GRCm38) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,927,178 (GRCm38) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,911,108 (GRCm38) nonsense probably null
IGL03101:Cfap65 APN 1 74,928,433 (GRCm38) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,927,619 (GRCm38) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,904,642 (GRCm38) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,928,342 (GRCm38) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,931,918 (GRCm38) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,931,958 (GRCm38) nonsense probably null
R0281:Cfap65 UTSW 1 74,927,071 (GRCm38) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,904,067 (GRCm38) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,929,302 (GRCm38) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,929,301 (GRCm38) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,926,444 (GRCm38) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,920,601 (GRCm38) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,925,440 (GRCm38) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,916,884 (GRCm38) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,918,444 (GRCm38) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,902,169 (GRCm38) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,918,887 (GRCm38) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,904,682 (GRCm38) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,921,519 (GRCm38) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,905,713 (GRCm38) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,902,447 (GRCm38) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,918,504 (GRCm38) splice site probably benign
R1159:Cfap65 UTSW 1 74,929,340 (GRCm38) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,925,104 (GRCm38) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,917,175 (GRCm38) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,918,948 (GRCm38) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,907,660 (GRCm38) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,917,199 (GRCm38) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,907,691 (GRCm38) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,917,273 (GRCm38) frame shift probably null
R2219:Cfap65 UTSW 1 74,904,025 (GRCm38) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,904,025 (GRCm38) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,926,475 (GRCm38) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,927,186 (GRCm38) small insertion probably benign
R3114:Cfap65 UTSW 1 74,927,132 (GRCm38) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,920,542 (GRCm38) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,927,681 (GRCm38) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,903,358 (GRCm38) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,907,612 (GRCm38) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,907,612 (GRCm38) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,904,056 (GRCm38) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,925,354 (GRCm38) intron probably benign
R4701:Cfap65 UTSW 1 74,918,908 (GRCm38) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,928,361 (GRCm38) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,927,632 (GRCm38) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,917,295 (GRCm38) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,925,557 (GRCm38) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,919,261 (GRCm38) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,907,613 (GRCm38) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,903,124 (GRCm38) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,906,336 (GRCm38) nonsense probably null
R5074:Cfap65 UTSW 1 74,922,978 (GRCm38) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,906,441 (GRCm38) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,926,516 (GRCm38) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,924,902 (GRCm38) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,903,175 (GRCm38) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,925,100 (GRCm38) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,907,518 (GRCm38) intron probably benign
R5669:Cfap65 UTSW 1 74,924,968 (GRCm38) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,923,031 (GRCm38) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,920,405 (GRCm38) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,903,139 (GRCm38) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,927,709 (GRCm38) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,904,685 (GRCm38) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,917,286 (GRCm38) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,932,021 (GRCm38) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,925,115 (GRCm38) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,931,899 (GRCm38) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,926,633 (GRCm38) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,926,604 (GRCm38) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,921,583 (GRCm38) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,920,426 (GRCm38) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,926,610 (GRCm38) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,902,434 (GRCm38) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,933,144 (GRCm38) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,928,368 (GRCm38) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,926,625 (GRCm38) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,933,162 (GRCm38) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,910,743 (GRCm38) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,928,044 (GRCm38) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,928,044 (GRCm38) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,917,169 (GRCm38) nonsense probably null
R8431:Cfap65 UTSW 1 74,928,044 (GRCm38) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,928,044 (GRCm38) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,905,937 (GRCm38) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,903,223 (GRCm38) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,902,188 (GRCm38) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,920,393 (GRCm38) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,904,688 (GRCm38) missense possibly damaging 0.88
R9187:Cfap65 UTSW 1 74,917,358 (GRCm38) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,920,408 (GRCm38) missense probably benign
R9212:Cfap65 UTSW 1 74,920,408 (GRCm38) missense probably benign
R9273:Cfap65 UTSW 1 74,921,610 (GRCm38) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,905,051 (GRCm38) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,906,309 (GRCm38) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,907,378 (GRCm38) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,919,342 (GRCm38) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,904,681 (GRCm38) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,905,647 (GRCm38) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,910,747 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGAGAGGCATCCAGTAAC -3'
(R):5'- AGTTCACTTTTCTGAGGCTCCAG -3'

Sequencing Primer
(F):5'- GAGGCATCCAGTAACACCCATG -3'
(R):5'- GAGGCTCCAGTTTCCATCATAATGAG -3'
Posted On 2022-09-30