Incidental Mutation 'R9601:Slc6a17'
ID 726337
Institutional Source Beutler Lab
Gene Symbol Slc6a17
Ensembl Gene ENSMUSG00000027894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 17
Synonyms NTT4, D130012J15Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R9601 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 107374864-107425334 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107380930 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 525 (D525G)
Ref Sequence ENSEMBL: ENSMUSP00000129379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029499] [ENSMUST00000168211] [ENSMUST00000169449]
AlphaFold Q8BJI1
Predicted Effect possibly damaging
Transcript: ENSMUST00000029499
AA Change: D522G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029499
Gene: ENSMUSG00000027894
AA Change: D522G

DomainStartEndE-ValueType
Pfam:SNF 60 640 2.7e-227 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168211
AA Change: D484G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131888
Gene: ENSMUSG00000027894
AA Change: D484G

DomainStartEndE-ValueType
Pfam:SNF 19 602 1.3e-225 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169449
AA Change: D525G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129379
Gene: ENSMUSG00000027894
AA Change: D525G

DomainStartEndE-ValueType
Pfam:SNF 60 643 1.1e-225 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. Defects in this gene are a cause of autosomal recessive mental retardation-48. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd6 T C 14: 8,049,808 (GRCm38) L246S possibly damaging Het
Ahcyl A G 16: 45,975,035 (GRCm39) I114T probably benign Het
Arhgap22 C A 14: 33,020,727 (GRCm39) H107N probably damaging Het
Atp6v0a2 G A 5: 124,790,257 (GRCm39) G480D probably damaging Het
Baz2b T C 2: 59,731,847 (GRCm39) T2064A possibly damaging Het
Bop1 T A 15: 76,338,688 (GRCm39) N449I probably benign Het
C8g C T 2: 25,388,916 (GRCm39) probably null Het
Camp T G 9: 109,677,504 (GRCm39) T110P Het
Ccdc141 T C 2: 76,885,073 (GRCm39) T523A possibly damaging Het
Ccdc157 A T 11: 4,094,598 (GRCm39) I578N probably damaging Het
Ccdc187 C T 2: 26,143,445 (GRCm39) A1298T possibly damaging Het
Cdc20 C T 4: 118,290,716 (GRCm39) W428* probably null Het
Chd9 A T 8: 91,732,360 (GRCm39) R1293* probably null Het
Clca3a1 C T 3: 144,453,310 (GRCm39) G505S probably benign Het
Clptm1 C A 7: 19,369,763 (GRCm39) W382C probably damaging Het
Cnot1 A T 8: 96,482,835 (GRCm39) N739K probably benign Het
Cntnap5a T C 1: 116,508,217 (GRCm39) I1243T probably damaging Het
Col12a1 T G 9: 79,525,034 (GRCm39) D2709A probably damaging Het
Cpm T C 10: 117,511,999 (GRCm39) probably null Het
Ctsd C A 7: 141,936,373 (GRCm39) G143C probably damaging Het
Cux2 A G 5: 122,025,461 (GRCm39) V69A possibly damaging Het
Cyp2c66 A T 19: 39,175,054 (GRCm39) I485L probably benign Het
Cyp4a29 T C 4: 115,105,772 (GRCm39) V158A probably damaging Het
Dbx1 A T 7: 49,282,403 (GRCm39) D267E probably damaging Het
Dop1b A G 16: 93,544,531 (GRCm39) Y224C possibly damaging Het
Dsg3 T A 18: 20,666,578 (GRCm39) C596S probably damaging Het
Fcgbpl1 G A 7: 27,853,805 (GRCm39) V1590I possibly damaging Het
Fgd2 G A 17: 29,593,860 (GRCm39) V456I probably benign Het
Gabra1 A T 11: 42,026,401 (GRCm39) I297N probably damaging Het
Grid1 A G 14: 35,167,814 (GRCm39) E446G probably damaging Het
H2bc12 T C 13: 22,220,393 (GRCm39) S113P probably benign Het
Hmmr A T 11: 40,598,210 (GRCm39) Y667* probably null Het
Katnip A G 7: 125,442,092 (GRCm39) Q693R probably benign Het
Klhl25 A G 7: 75,515,757 (GRCm39) D221G probably damaging Het
Krtcap2 T C 3: 89,156,449 (GRCm39) probably null Het
Lipi T A 16: 75,352,706 (GRCm39) N377I possibly damaging Het
Lrp2 C A 2: 69,289,928 (GRCm39) C3637F probably damaging Het
Mrgprh T C 17: 13,096,264 (GRCm39) F168S possibly damaging Het
Naip6 T C 13: 100,436,961 (GRCm39) T521A probably benign Het
Nkpd1 A T 7: 19,257,462 (GRCm39) I414F probably damaging Het
Or4c99 T A 2: 88,330,314 (GRCm39) M295K probably damaging Het
Or52z13 A T 7: 103,246,598 (GRCm39) D25V probably benign Het
Pcdhb21 A T 18: 37,648,385 (GRCm39) I505F probably damaging Het
Plxna1 C T 6: 89,308,253 (GRCm39) R1278Q probably damaging Het
Pofut2 T C 10: 77,095,220 (GRCm39) S22P possibly damaging Het
Prrc2b C A 2: 32,090,953 (GRCm39) R442S probably damaging Het
Sema3e T A 5: 14,302,397 (GRCm39) F641I possibly damaging Het
Sfswap G A 5: 129,618,463 (GRCm39) V466I possibly damaging Het
Slc22a21 A T 11: 53,850,051 (GRCm39) V268E possibly damaging Het
Spata21 C T 4: 140,822,467 (GRCm39) T91I possibly damaging Het
Spryd7 T G 14: 61,783,228 (GRCm39) H98P probably benign Het
Sptb G T 12: 76,667,763 (GRCm39) T778K probably damaging Het
Syne1 C T 10: 5,209,270 (GRCm39) R3411Q probably benign Het
Trank1 A G 9: 111,202,193 (GRCm39) I1607V probably benign Het
Ttll1 T C 15: 83,380,516 (GRCm39) D283G probably benign Het
Ufl1 G A 4: 25,275,807 (GRCm39) R199W probably benign Het
Vmn1r159 A G 7: 22,542,616 (GRCm39) S139P probably damaging Het
Vmn2r97 A G 17: 19,134,770 (GRCm39) I63V probably benign Het
Vps13a T C 19: 16,623,337 (GRCm39) S2775G possibly damaging Het
Zfp992 C T 4: 146,551,976 (GRCm39) H566Y probably damaging Het
Other mutations in Slc6a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Slc6a17 APN 3 107,400,493 (GRCm39) missense possibly damaging 0.56
IGL02514:Slc6a17 APN 3 107,402,993 (GRCm39) missense possibly damaging 0.94
IGL03395:Slc6a17 APN 3 107,384,622 (GRCm39) missense probably damaging 1.00
BB002:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
BB012:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R0454:Slc6a17 UTSW 3 107,384,183 (GRCm39) missense probably benign 0.12
R1201:Slc6a17 UTSW 3 107,400,388 (GRCm39) missense possibly damaging 0.90
R1551:Slc6a17 UTSW 3 107,379,443 (GRCm39) missense possibly damaging 0.85
R1681:Slc6a17 UTSW 3 107,381,702 (GRCm39) missense probably damaging 1.00
R1721:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R1765:Slc6a17 UTSW 3 107,380,895 (GRCm39) missense possibly damaging 0.95
R1867:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R2167:Slc6a17 UTSW 3 107,398,817 (GRCm39) nonsense probably null
R3708:Slc6a17 UTSW 3 107,400,401 (GRCm39) missense probably benign
R3814:Slc6a17 UTSW 3 107,378,633 (GRCm39) missense possibly damaging 0.92
R4639:Slc6a17 UTSW 3 107,381,597 (GRCm39) missense probably benign
R4807:Slc6a17 UTSW 3 107,407,803 (GRCm39) missense possibly damaging 0.90
R5048:Slc6a17 UTSW 3 107,378,753 (GRCm39) nonsense probably null
R6076:Slc6a17 UTSW 3 107,379,387 (GRCm39) missense possibly damaging 0.67
R6326:Slc6a17 UTSW 3 107,407,722 (GRCm39) missense probably damaging 0.98
R6713:Slc6a17 UTSW 3 107,378,703 (GRCm39) missense probably benign 0.00
R7073:Slc6a17 UTSW 3 107,378,755 (GRCm39) missense probably benign 0.00
R7097:Slc6a17 UTSW 3 107,400,464 (GRCm39) missense probably damaging 1.00
R7323:Slc6a17 UTSW 3 107,398,794 (GRCm39) missense probably benign 0.01
R7597:Slc6a17 UTSW 3 107,378,668 (GRCm39) missense possibly damaging 0.89
R7755:Slc6a17 UTSW 3 107,381,671 (GRCm39) missense probably damaging 1.00
R7841:Slc6a17 UTSW 3 107,384,214 (GRCm39) missense possibly damaging 0.69
R7925:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R8041:Slc6a17 UTSW 3 107,381,744 (GRCm39) missense probably damaging 1.00
R8305:Slc6a17 UTSW 3 107,380,901 (GRCm39) missense probably benign 0.31
R8306:Slc6a17 UTSW 3 107,380,985 (GRCm39) missense probably benign
R8488:Slc6a17 UTSW 3 107,384,574 (GRCm39) missense possibly damaging 0.84
R8930:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R8932:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R9287:Slc6a17 UTSW 3 107,384,551 (GRCm39) missense probably damaging 1.00
R9483:Slc6a17 UTSW 3 107,378,772 (GRCm39) missense possibly damaging 0.50
R9617:Slc6a17 UTSW 3 107,384,685 (GRCm39) missense probably damaging 1.00
X0010:Slc6a17 UTSW 3 107,400,422 (GRCm39) missense probably benign 0.05
X0062:Slc6a17 UTSW 3 107,407,684 (GRCm39) missense probably null 1.00
Z1176:Slc6a17 UTSW 3 107,384,082 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCCCTTTCAAAAGCAGCC -3'
(R):5'- TCAGAACCTCAGCTTCCAGC -3'

Sequencing Primer
(F):5'- CCTTTCAAAAGCAGCCATGAG -3'
(R):5'- CTCTCTGTAGTTGGCTGCTG -3'
Posted On 2022-10-06