Mutagenetix > Incidental Mutation

Incidental Mutation 'R9601:Atp6v0a2'

726346

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R9601 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 124713193 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 480 (G480D)

Ref Sequence

ENSEMBL: ENSMUSP00000039737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]

AlphaFold

P15920

PDB Structure

NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037865
AA Change: G480D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: G480D

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000198382

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	G	A	7: 28,154,380	V1590I	possibly damaging	Het
Abhd6	T	C	14: 8,049,808	L246S	possibly damaging	Het
Arhgap22	C	A	14: 33,298,770	H107N	probably damaging	Het
Baz2b	T	C	2: 59,901,503	T2064A	possibly damaging	Het
Bop1	T	A	15: 76,454,488	N449I	probably benign	Het
C8g	C	T	2: 25,498,904		probably null	Het
Camp	T	G	9: 109,848,436	T110P		Het
Ccdc141	T	C	2: 77,054,729	T523A	possibly damaging	Het
Ccdc157	A	T	11: 4,144,598	I578N	probably damaging	Het
Ccdc187	C	T	2: 26,253,433	A1298T	possibly damaging	Het
Cdc20	C	T	4: 118,433,519	W428*	probably null	Het
Chd9	A	T	8: 91,005,732	R1293*	probably null	Het
Clca3a1	C	T	3: 144,747,549	G505S	probably benign	Het
Clptm1	C	A	7: 19,635,838	W382C	probably damaging	Het
Cnot1	A	T	8: 95,756,207	N739K	probably benign	Het
Cntnap5a	T	C	1: 116,580,487	I1243T	probably damaging	Het
Col12a1	T	G	9: 79,617,752	D2709A	probably damaging	Het
Cpm	T	C	10: 117,676,094		probably null	Het
Ctsd	C	A	7: 142,382,636	G143C	probably damaging	Het
Cux2	A	G	5: 121,887,398	V69A	possibly damaging	Het
Cyp2c66	A	T	19: 39,186,610	I485L	probably benign	Het
Cyp4a29	T	C	4: 115,248,575	V158A	probably damaging	Het
D430042O09Rik	A	G	7: 125,842,920	Q693R	probably benign	Het
Dbx1	A	T	7: 49,632,655	D267E	probably damaging	Het
Dopey2	A	G	16: 93,747,643	Y224C	possibly damaging	Het
Dsg3	T	A	18: 20,533,521	C596S	probably damaging	Het
Fgd2	G	A	17: 29,374,886	V456I	probably benign	Het
Gabra1	A	T	11: 42,135,574	I297N	probably damaging	Het
Gm4737	A	G	16: 46,154,672	I114T	probably benign	Het
Grid1	A	G	14: 35,445,857	E446G	probably damaging	Het
Hist1h2bk	T	C	13: 22,036,223	S113P	probably benign	Het
Hmmr	A	T	11: 40,707,383	Y667*	probably null	Het
Klhl25	A	G	7: 75,866,009	D221G	probably damaging	Het
Krtcap2	T	C	3: 89,249,142		probably null	Het
Lipi	T	A	16: 75,555,818	N377I	possibly damaging	Het
Lrp2	C	A	2: 69,459,584	C3637F	probably damaging	Het
Mrgprh	T	C	17: 12,877,377	F168S	possibly damaging	Het
Naip6	T	C	13: 100,300,453	T521A	probably benign	Het
Nkpd1	A	T	7: 19,523,537	I414F	probably damaging	Het
Olfr1185-ps1	T	A	2: 88,499,970	M295K	probably damaging	Het
Olfr618	A	T	7: 103,597,391	D25V	probably benign	Het
Pcdhb21	A	T	18: 37,515,332	I505F	probably damaging	Het
Plxna1	C	T	6: 89,331,271	R1278Q	probably damaging	Het
Pofut2	T	C	10: 77,259,386	S22P	possibly damaging	Het
Prrc2b	C	A	2: 32,200,941	R442S	probably damaging	Het
Sema3e	T	A	5: 14,252,383	F641I	possibly damaging	Het
Sfswap	G	A	5: 129,541,399	V466I	possibly damaging	Het
Slc22a21	A	T	11: 53,959,225	V268E	possibly damaging	Het
Slc6a17	T	C	3: 107,473,614	D525G	possibly damaging	Het
Spata21	C	T	4: 141,095,156	T91I	possibly damaging	Het
Spryd7	T	G	14: 61,545,779	H98P	probably benign	Het
Sptb	G	T	12: 76,620,989	T778K	probably damaging	Het
Syne1	C	T	10: 5,259,270	R3411Q	probably benign	Het
Trank1	A	G	9: 111,373,125	I1607V	probably benign	Het
Ttll1	T	C	15: 83,496,315	D283G	probably benign	Het
Ufl1	G	A	4: 25,275,807	R199W	probably benign	Het
Vmn1r159	A	G	7: 22,843,191	S139P	probably damaging	Het
Vmn2r97	A	G	17: 18,914,508	I63V	probably benign	Het
Vps13a	T	C	19: 16,645,973	S2775G	possibly damaging	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- GGAATGAGCCATTATGATCCTCC -3'
(R):5'- AGCTGCAAAGTCCTGCTGTG -3'

Sequencing Primer
(F):5'- TCCCAGGAGCCCACTGTC -3'
(R):5'- CCTGATGGTGCTGTCACTGAAAC -3'

Posted On

2022-10-06