Incidental Mutation 'R9605:Pikfyve'
ID 726391
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms PipkIII, Pip5k3, 5230400C17Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9605 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 65225842-65317854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 65303561 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 1694 (S1694C)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]
AlphaFold Q9Z1T6
Predicted Effect possibly damaging
Transcript: ENSMUST00000081154
AA Change: S1649C

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: S1649C

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097707
AA Change: S1694C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: S1694C

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,872,380 (GRCm39) V103I possibly damaging Het
Aatk T C 11: 119,902,209 (GRCm39) E729G possibly damaging Het
Acaa2 A G 18: 74,932,230 (GRCm39) T290A probably benign Het
Acaca C T 11: 84,183,842 (GRCm39) T1240I probably benign Het
Adgre1 A G 17: 57,718,083 (GRCm39) N365S probably benign Het
Adipor1 A G 1: 134,352,553 (GRCm39) D108G probably damaging Het
Aebp2 A G 6: 140,593,736 (GRCm39) Q462R probably damaging Het
Afg2a C T 3: 37,505,930 (GRCm39) P670S probably damaging Het
Arhgef4 A G 1: 34,761,745 (GRCm39) T334A unknown Het
Art5 T C 7: 101,746,412 (GRCm39) E280G probably benign Het
Bloc1s3 A G 7: 19,241,457 (GRCm39) S24P possibly damaging Het
C2 T A 17: 35,081,958 (GRCm39) N720I possibly damaging Het
Caprin2 T C 6: 148,744,332 (GRCm39) D1031G probably damaging Het
Catsper1 A G 19: 5,387,785 (GRCm39) T355A probably benign Het
Cd19 T A 7: 126,010,057 (GRCm39) E398D possibly damaging Het
Cdca8 T C 4: 124,830,384 (GRCm39) E31G probably damaging Het
Ceacam5 G A 7: 17,493,520 (GRCm39) V848M probably damaging Het
Chd8 A T 14: 52,457,055 (GRCm39) L971Q probably damaging Het
Ciao1 G A 2: 127,087,684 (GRCm39) T217I probably damaging Het
Cldn1 A T 16: 26,181,924 (GRCm39) I95N probably damaging Het
Clip2 C T 5: 134,533,616 (GRCm39) R487Q probably benign Het
Cluh C T 11: 74,558,772 (GRCm39) R1253C possibly damaging Het
Cngb3 A T 4: 19,505,187 (GRCm39) Q640L probably benign Het
Cspg4b T C 13: 113,456,503 (GRCm39) S850P Het
Cyp2c40 A T 19: 39,766,443 (GRCm39) V384D probably damaging Het
Cyp2d26 T A 15: 82,674,672 (GRCm39) M437L probably benign Het
D430041D05Rik A G 2: 104,087,189 (GRCm39) S596P probably benign Het
Dagla A T 19: 10,233,053 (GRCm39) V448D probably damaging Het
Ddx59 A T 1: 136,344,594 (GRCm39) E88D probably benign Het
Dock1 T A 7: 134,384,141 (GRCm39) F671I possibly damaging Het
Dtna T A 18: 23,764,454 (GRCm39) V541D probably damaging Het
Eef2k T C 7: 120,491,170 (GRCm39) F552S probably damaging Het
Erbb2 T C 11: 98,311,746 (GRCm39) V94A possibly damaging Het
Etl4 A T 2: 20,771,345 (GRCm39) I607F possibly damaging Het
Ets2 G T 16: 95,516,121 (GRCm39) E234* probably null Het
Fbp1 A C 13: 63,019,023 (GRCm39) V175G probably damaging Het
Fmn2 C T 1: 174,436,194 (GRCm39) Q722* probably null Het
Fnip1 G T 11: 54,381,713 (GRCm39) R288L probably benign Het
Ghr G A 15: 3,362,993 (GRCm39) P160S probably damaging Het
Glipr1 A G 10: 111,832,801 (GRCm39) S46P probably damaging Het
Kif19b A T 5: 140,455,461 (GRCm39) T356S probably benign Het
Kif9 G A 9: 110,346,710 (GRCm39) R616H probably benign Het
Krt87 G T 15: 101,336,484 (GRCm39) C56* probably null Het
Ldlr A G 9: 21,646,626 (GRCm39) D264G probably damaging Het
Lrrk2 A T 15: 91,621,420 (GRCm39) D998V probably benign Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mrc1 A G 2: 14,324,110 (GRCm39) N1149S probably benign Het
Myo1c T A 11: 75,559,899 (GRCm39) V661E probably benign Het
N4bp2 T C 5: 65,963,879 (GRCm39) S643P probably benign Het
Nbl1 T A 4: 138,812,608 (GRCm39) T75S probably benign Het
Ndn C T 7: 61,998,337 (GRCm39) P61L possibly damaging Het
Nqo2 T A 13: 34,156,361 (GRCm39) V25E possibly damaging Het
Oma1 G T 4: 103,210,726 (GRCm39) V411L possibly damaging Het
Or12e13 T G 2: 87,663,478 (GRCm39) F32V probably benign Het
Or5v1 T A 17: 37,810,331 (GRCm39) I263N probably damaging Het
Or8b12i A G 9: 20,082,093 (GRCm39) V258A probably damaging Het
Osgin2 G T 4: 15,998,427 (GRCm39) H398Q probably damaging Het
Pepd A C 7: 34,743,218 (GRCm39) D419A probably benign Het
Pirb G A 7: 3,720,617 (GRCm39) R294C possibly damaging Het
Plec A T 15: 76,065,213 (GRCm39) L1619Q unknown Het
Polq A G 16: 36,843,173 (GRCm39) I236V probably benign Het
Pphln1-ps1 A G 16: 13,495,087 (GRCm39) D62G probably benign Het
Prkag3 T G 1: 74,786,378 (GRCm39) Q189P probably damaging Het
Prkcg A T 7: 3,359,360 (GRCm39) M136L probably benign Het
Ptprn2 T C 12: 117,125,278 (GRCm39) L604P probably benign Het
Rab6b A T 9: 103,017,601 (GRCm39) T31S probably benign Het
Rnf213 A G 11: 119,359,879 (GRCm39) N4424S Het
Ryr3 A T 2: 112,491,966 (GRCm39) L3795Q probably damaging Het
Scg2 A G 1: 79,412,936 (GRCm39) Y556H probably damaging Het
Serpina3j A G 12: 104,286,093 (GRCm39) N416S probably damaging Het
Sik3 T A 9: 46,120,117 (GRCm39) H735Q probably benign Het
Slain1 A C 14: 103,902,112 (GRCm39) T60P Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc46a2 A T 4: 59,914,056 (GRCm39) V289E probably damaging Het
Sorcs3 A T 19: 48,711,364 (GRCm39) Y643F probably damaging Het
Sox30 A G 11: 45,875,640 (GRCm39) N464S possibly damaging Het
Spta1 A G 1: 174,035,880 (GRCm39) Y1062C probably damaging Het
Srrm3 A G 5: 135,881,105 (GRCm39) D135G probably damaging Het
Stat5b T A 11: 100,699,276 (GRCm39) H25L possibly damaging Het
Synj2 A G 17: 6,063,794 (GRCm39) I513V probably benign Het
Syt11 T A 3: 88,669,325 (GRCm39) Q189L probably benign Het
Tbc1d1 G A 5: 64,443,350 (GRCm39) R523Q probably damaging Het
Traf3ip2 T A 10: 39,521,772 (GRCm39) D443E probably benign Het
Traf6 G T 2: 101,524,625 (GRCm39) C235F probably damaging Het
Treh A G 9: 44,592,416 (GRCm39) D47G probably damaging Het
Trpc4 C A 3: 54,225,550 (GRCm39) H966Q probably benign Het
Ttbk1 A T 17: 46,784,516 (GRCm39) D316E possibly damaging Het
Txndc16 A T 14: 45,442,799 (GRCm39) F132Y probably damaging Het
Uggt1 A T 1: 36,273,886 (GRCm39) probably null Het
Usp25 A T 16: 76,874,046 (GRCm39) I541F probably damaging Het
Xirp1 A T 9: 119,847,274 (GRCm39) D536E possibly damaging Het
Zfp51 A G 17: 21,684,291 (GRCm39) E302G probably damaging Het
Zfp648 A T 1: 154,080,110 (GRCm39) T90S probably benign Het
Zfp84 A G 7: 29,476,264 (GRCm39) T319A possibly damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65,299,280 (GRCm39) critical splice donor site probably null
IGL01135:Pikfyve APN 1 65,290,794 (GRCm39) missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65,298,028 (GRCm39) nonsense probably null
IGL01759:Pikfyve APN 1 65,292,512 (GRCm39) missense probably benign 0.06
IGL01888:Pikfyve APN 1 65,262,799 (GRCm39) missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65,303,524 (GRCm39) missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65,277,703 (GRCm39) critical splice donor site probably null
IGL02119:Pikfyve APN 1 65,311,730 (GRCm39) missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65,285,556 (GRCm39) missense probably benign 0.13
IGL02207:Pikfyve APN 1 65,290,837 (GRCm39) critical splice donor site probably null
IGL02380:Pikfyve APN 1 65,295,180 (GRCm39) missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65,291,728 (GRCm39) missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65,283,663 (GRCm39) missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65,290,771 (GRCm39) missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65,303,535 (GRCm39) missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65,270,014 (GRCm39) critical splice donor site probably null
IGL02746:Pikfyve APN 1 65,273,431 (GRCm39) missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65,289,353 (GRCm39) nonsense probably null
IGL02890:Pikfyve APN 1 65,269,956 (GRCm39) missense probably benign 0.00
IGL03102:Pikfyve APN 1 65,291,626 (GRCm39) nonsense probably null
IGL03294:Pikfyve APN 1 65,286,226 (GRCm39) missense probably damaging 1.00
falcon UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
oompa UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
wonka UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65,242,075 (GRCm39) missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65,255,088 (GRCm39) splice site probably benign
R0196:Pikfyve UTSW 1 65,295,231 (GRCm39) missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65,302,064 (GRCm39) missense probably benign 0.41
R0319:Pikfyve UTSW 1 65,285,490 (GRCm39) missense probably benign 0.01
R0332:Pikfyve UTSW 1 65,303,558 (GRCm39) missense probably benign 0.02
R0389:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65,259,058 (GRCm39) missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65,292,682 (GRCm39) missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65,292,556 (GRCm39) missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65,304,983 (GRCm39) missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65,286,118 (GRCm39) missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65,310,470 (GRCm39) missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65,263,360 (GRCm39) missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65,302,136 (GRCm39) critical splice donor site probably null
R1501:Pikfyve UTSW 1 65,304,443 (GRCm39) missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65,291,707 (GRCm39) missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65,285,529 (GRCm39) missense probably benign
R1773:Pikfyve UTSW 1 65,231,430 (GRCm39) missense probably damaging 0.99
R1795:Pikfyve UTSW 1 65,291,716 (GRCm39) missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65,297,957 (GRCm39) missense probably benign 0.03
R1905:Pikfyve UTSW 1 65,231,454 (GRCm39) critical splice donor site probably null
R1995:Pikfyve UTSW 1 65,285,867 (GRCm39) missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65,261,516 (GRCm39) missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65,292,512 (GRCm39) missense probably benign 0.06
R2229:Pikfyve UTSW 1 65,307,014 (GRCm39) missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65,285,835 (GRCm39) missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65,292,676 (GRCm39) missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65,284,917 (GRCm39) missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65,283,579 (GRCm39) missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65,270,004 (GRCm39) missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65,235,840 (GRCm39) missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65,229,679 (GRCm39) unclassified probably benign
R4542:Pikfyve UTSW 1 65,283,589 (GRCm39) missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65,231,351 (GRCm39) missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65,273,421 (GRCm39) missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4716:Pikfyve UTSW 1 65,285,635 (GRCm39) missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65,311,674 (GRCm39) missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4785:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4805:Pikfyve UTSW 1 65,307,959 (GRCm39) missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65,285,749 (GRCm39) missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65,263,276 (GRCm39) intron probably benign
R5265:Pikfyve UTSW 1 65,306,988 (GRCm39) missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65,235,858 (GRCm39) nonsense probably null
R5384:Pikfyve UTSW 1 65,283,568 (GRCm39) missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65,304,427 (GRCm39) missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65,274,192 (GRCm39) missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65,291,654 (GRCm39) missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65,312,889 (GRCm39) missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65,295,247 (GRCm39) missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65,255,187 (GRCm39) missense probably benign 0.09
R5891:Pikfyve UTSW 1 65,241,896 (GRCm39) missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65,292,597 (GRCm39) nonsense probably null
R6026:Pikfyve UTSW 1 65,311,856 (GRCm39) missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65,311,730 (GRCm39) missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65,255,202 (GRCm39) missense probably benign 0.36
R6287:Pikfyve UTSW 1 65,292,691 (GRCm39) critical splice donor site probably null
R6290:Pikfyve UTSW 1 65,242,084 (GRCm39) critical splice donor site probably null
R6296:Pikfyve UTSW 1 65,302,112 (GRCm39) missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65,304,940 (GRCm39) missense probably benign 0.35
R6835:Pikfyve UTSW 1 65,298,002 (GRCm39) missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65,291,689 (GRCm39) missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65,285,822 (GRCm39) missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65,273,520 (GRCm39) missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65,286,013 (GRCm39) missense probably benign 0.01
R7057:Pikfyve UTSW 1 65,286,364 (GRCm39) missense probably benign 0.00
R7525:Pikfyve UTSW 1 65,283,585 (GRCm39) nonsense probably null
R7558:Pikfyve UTSW 1 65,311,782 (GRCm39) missense probably benign 0.01
R7625:Pikfyve UTSW 1 65,307,036 (GRCm39) missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65,309,101 (GRCm39) missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65,304,948 (GRCm39) missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65,285,554 (GRCm39) missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65,292,501 (GRCm39) splice site probably benign
R8307:Pikfyve UTSW 1 65,284,894 (GRCm39) missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65,255,155 (GRCm39) missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65,283,576 (GRCm39) missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65,310,427 (GRCm39) missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65,286,129 (GRCm39) missense probably benign 0.00
R8995:Pikfyve UTSW 1 65,244,746 (GRCm39) critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65,283,559 (GRCm39) missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65,285,239 (GRCm39) missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65,235,898 (GRCm39) missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65,299,188 (GRCm39) missense probably benign 0.37
R9368:Pikfyve UTSW 1 65,307,901 (GRCm39) missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9686:Pikfyve UTSW 1 65,291,615 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTAATGTATTTGTTTAACTACGGGC -3'
(R):5'- CTATACGCTAAGGTCTGTGTAAGGTC -3'

Sequencing Primer
(F):5'- TTTGTTTAACTACGGGCACATATAG -3'
(R):5'- GACTTGAATTTTGTTGCTCCAAC -3'
Posted On 2022-10-06