Mutagenetix > Incidental Mutation

Incidental Mutation 'R9605:Pikfyve'

726391

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

Pip5k3

MMRRC Submission

Accession Numbers

Genbank: NM_011086

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9605 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

65186683-65278695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 65264402 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 1694 (S1694C)

Ref Sequence

ENSEMBL: ENSMUSP00000095314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]

AlphaFold

Q9Z1T6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081154
AA Change: S1649C

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: S1649C

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000097707
AA Change: S1694C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: S1694C

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110001I22Rik	A	G	16: 13,677,223	D62G	probably benign	Het
6430548M08Rik	G	A	8: 120,145,641	V103I	possibly damaging	Het
Aatk	T	C	11: 120,011,383	E729G	possibly damaging	Het
Acaa2	A	G	18: 74,799,159	T290A	probably benign	Het
Acaca	C	T	11: 84,293,016	T1240I	probably benign	Het
Adgre1	A	G	17: 57,411,083	N365S	probably benign	Het
Adipor1	A	G	1: 134,424,815	D108G	probably damaging	Het
Aebp2	A	G	6: 140,648,010	Q462R	probably damaging	Het
Arhgef4	A	G	1: 34,722,664	T334A	unknown	Het
Art5	T	C	7: 102,097,205	E280G	probably benign	Het
BC067074	T	C	13: 113,319,969	S850P		Het
Bloc1s3	A	G	7: 19,507,532	S24P	possibly damaging	Het
C2	T	A	17: 34,862,982	N720I	possibly damaging	Het
Caprin2	T	C	6: 148,842,834	D1031G	probably damaging	Het
Catsper1	A	G	19: 5,337,757	T355A	probably benign	Het
Cd19	T	A	7: 126,410,885	E398D	possibly damaging	Het
Cdca8	T	C	4: 124,936,591	E31G	probably damaging	Het
Ceacam5	G	A	7: 17,759,595	V848M	probably damaging	Het
Chd8	A	T	14: 52,219,598	L971Q	probably damaging	Het
Ciao1	G	A	2: 127,245,764	T217I	probably damaging	Het
Cldn1	A	T	16: 26,363,174	I95N	probably damaging	Het
Clip2	C	T	5: 134,504,762	R487Q	probably benign	Het
Cluh	C	T	11: 74,667,946	R1253C	possibly damaging	Het
Cngb3	A	T	4: 19,505,187	Q640L	probably benign	Het
Cyp2c40	A	T	19: 39,777,999	V384D	probably damaging	Het
Cyp2d26	T	A	15: 82,790,471	M437L	probably benign	Het
D430041D05Rik	A	G	2: 104,256,844	S596P	probably benign	Het
Dagla	A	T	19: 10,255,689	V448D	probably damaging	Het
Ddx59	A	T	1: 136,416,856	E88D	probably benign	Het
Dock1	T	A	7: 134,782,412	F671I	possibly damaging	Het
Dtna	T	A	18: 23,631,397	V541D	probably damaging	Het
Eef2k	T	C	7: 120,891,947	F552S	probably damaging	Het
Erbb2	T	C	11: 98,420,920	V94A	possibly damaging	Het
Etl4	A	T	2: 20,766,534	I607F	possibly damaging	Het
Ets2	G	T	16: 95,715,077	E234*	probably null	Het
Fbp1	A	C	13: 62,871,209	V175G	probably damaging	Het
Fmn2	C	T	1: 174,608,628	Q722*	probably null	Het
Fnip1	G	T	11: 54,490,887	R288L	probably benign	Het
Ghr	G	A	15: 3,333,511	P160S	probably damaging	Het
Glipr1	A	G	10: 111,996,896	S46P	probably damaging	Het
Gm4869	A	T	5: 140,469,706	T356S	probably benign	Het
Kif9	G	A	9: 110,517,642	R616H	probably benign	Het
Krt87	G	T	15: 101,438,603	C56*	probably null	Het
Ldlr	A	G	9: 21,735,330	D264G	probably damaging	Het
Lrrk2	A	T	15: 91,737,217	D998V	probably benign	Het
Mcm5	C	T	8: 75,117,540	S313F	probably benign	Het
Mrc1	A	G	2: 14,319,299	N1149S	probably benign	Het
Myo1c	T	A	11: 75,669,073	V661E	probably benign	Het
N4bp2	T	C	5: 65,806,536	S643P	probably benign	Het
Nbl1	T	A	4: 139,085,297	T75S	probably benign	Het
Ndn	C	T	7: 62,348,589	P61L	possibly damaging	Het
Nqo2	T	A	13: 33,972,378	V25E	possibly damaging	Het
Olfr110	T	A	17: 37,499,440	I263N	probably damaging	Het
Olfr1148	T	G	2: 87,833,134	F32V	probably benign	Het
Olfr870	A	G	9: 20,170,797	V258A	probably damaging	Het
Oma1	G	T	4: 103,353,529	V411L	possibly damaging	Het
Osgin2	G	T	4: 15,998,427	H398Q	probably damaging	Het
Pepd	A	C	7: 35,043,793	D419A	probably benign	Het
Pirb	G	A	7: 3,717,618	R294C	possibly damaging	Het
Plec	A	T	15: 76,181,013	L1619Q	unknown	Het
Polq	A	G	16: 37,022,811	I236V	probably benign	Het
Prkag3	T	G	1: 74,747,219	Q189P	probably damaging	Het
Prkcg	A	T	7: 3,310,844	M136L	probably benign	Het
Ptprn2	T	C	12: 117,161,658	L604P	probably benign	Het
Rab6b	A	T	9: 103,140,402	T31S	probably benign	Het
Rnf213	A	G	11: 119,469,053	N4424S		Het
Ryr3	A	T	2: 112,661,621	L3795Q	probably damaging	Het
Scg2	A	G	1: 79,435,219	Y556H	probably damaging	Het
Serpina3j	A	G	12: 104,319,834	N416S	probably damaging	Het
Sik3	T	A	9: 46,208,819	H735Q	probably benign	Het
Slain1	A	C	14: 103,664,676	T60P		Het
Slc14a1	C	A	18: 78,109,592	A367S	probably damaging	Het
Slc46a2	A	T	4: 59,914,056	V289E	probably damaging	Het
Sorcs3	A	T	19: 48,722,925	Y643F	probably damaging	Het
Sox30	A	G	11: 45,984,813	N464S	possibly damaging	Het
Spata5	C	T	3: 37,451,781	P670S	probably damaging	Het
Spta1	A	G	1: 174,208,314	Y1062C	probably damaging	Het
Srrm3	A	G	5: 135,852,251	D135G	probably damaging	Het
Stat5b	T	A	11: 100,808,450	H25L	possibly damaging	Het
Synj2	A	G	17: 6,013,519	I513V	probably benign	Het
Syt11	T	A	3: 88,762,018	Q189L	probably benign	Het
Tbc1d1	G	A	5: 64,286,007	R523Q	probably damaging	Het
Traf3ip2	T	A	10: 39,645,776	D443E	probably benign	Het
Traf6	G	T	2: 101,694,280	C235F	probably damaging	Het
Treh	A	G	9: 44,681,119	D47G	probably damaging	Het
Trpc4	C	A	3: 54,318,129	H966Q	probably benign	Het
Ttbk1	A	T	17: 46,473,590	D316E	possibly damaging	Het
Txndc16	A	T	14: 45,205,342	F132Y	probably damaging	Het
Uggt1	A	T	1: 36,234,805		probably null	Het
Usp25	A	T	16: 77,077,158	I541F	probably damaging	Het
Xirp1	A	T	9: 120,018,208	D536E	possibly damaging	Het
Zfp51	A	G	17: 21,464,029	E302G	probably damaging	Het
Zfp648	A	T	1: 154,204,364	T90S	probably benign	Het
Zfp84	A	G	7: 29,776,839	T319A	possibly damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65260121	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65251635	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65258869	nonsense	probably null
IGL01759:Pikfyve	APN	1	65253353	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65223640	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65264365	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65238544	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65272571	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65246397	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65251678	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65256021	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65252569	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65244504	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65251612	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65264376	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65230855	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65234272	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65250194	nonsense	probably null
IGL02890:Pikfyve	APN	1	65230797	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65252467	nonsense	probably null
IGL03294:Pikfyve	APN	1	65247067	missense	probably damaging	1.00
falcon	UTSW	1	65196741	missense	probably damaging	1.00
oompa	UTSW	1	65196706	missense	probably damaging	1.00
wonka	UTSW	1	65196706	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65202916	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65215929	splice site	probably benign
R0196:Pikfyve	UTSW	1	65256072	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65262905	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65246331	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65264399	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65219899	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65253523	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65253397	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65265824	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65246959	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65271311	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65224201	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65262977	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65265284	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65252548	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65192271	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65246370	missense	probably benign
R1795:Pikfyve	UTSW	1	65252557	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65258798	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65192295	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65246708	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65222357	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65253353	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65267855	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65246676	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65253517	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65245758	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65244420	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65230845	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65196681	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65190520	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65244430	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65192192	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65234262	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65267846	missense	probably benign
R4716:Pikfyve	UTSW	1	65246476	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65272515	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65267846	missense	probably benign
R4785:Pikfyve	UTSW	1	65267846	missense	probably benign
R4805:Pikfyve	UTSW	1	65268800	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65196741	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65246590	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65224117	intron	probably benign
R5265:Pikfyve	UTSW	1	65267829	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65196699	nonsense	probably null
R5384:Pikfyve	UTSW	1	65244409	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65265268	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65235033	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65252495	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65273730	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65256088	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65216028	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65202737	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65253438	nonsense	probably null
R6026:Pikfyve	UTSW	1	65272697	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65272571	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65216043	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65253532	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65202925	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65262953	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65265781	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65258843	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65252530	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65246663	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65234361	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65246854	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65247205	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65244426	nonsense	probably null
R7558:Pikfyve	UTSW	1	65272623	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65267877	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65269942	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65265789	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65246395	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65253342	splice site	probably benign
R8307:Pikfyve	UTSW	1	65245735	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65215996	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65244417	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65271268	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65246970	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65205587	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65244400	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65246080	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65196739	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65260029	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65268742	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65264402	missense	probably benign
R9686:Pikfyve	UTSW	1	65252456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTAATGTATTTGTTTAACTACGGGC -3'
(R):5'- CTATACGCTAAGGTCTGTGTAAGGTC -3'

Sequencing Primer
(F):5'- TTTGTTTAACTACGGGCACATATAG -3'
(R):5'- GACTTGAATTTTGTTGCTCCAAC -3'

Posted On

2022-10-06