Incidental Mutation 'R9605:Eef2k'
ID 726430
Institutional Source Beutler Lab
Gene Symbol Eef2k
Ensembl Gene ENSMUSG00000035064
Gene Name eukaryotic elongation factor-2 kinase
Synonyms eEF-2K
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R9605 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 120842831-120907450 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120891947 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 552 (F552S)
Ref Sequence ENSEMBL: ENSMUSP00000046595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047875] [ENSMUST00000106487] [ENSMUST00000106488] [ENSMUST00000106489] [ENSMUST00000146482]
AlphaFold O08796
Predicted Effect probably damaging
Transcript: ENSMUST00000047875
AA Change: F552S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046595
Gene: ENSMUSG00000035064
AA Change: F552S

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 525 562 7.2e-5 PFAM
Pfam:Sel1 564 608 2.9e-3 PFAM
Pfam:Sel1 609 645 1.3e-1 PFAM
Pfam:Sel1 665 699 1.2e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106487
SMART Domains Protein: ENSMUSP00000102096
Gene: ENSMUSG00000035064

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 1e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
Pfam:Sel1 432 472 1.8e-3 PFAM
Pfam:Sel1 474 518 7.2e-3 PFAM
Pfam:Sel1 519 555 8e-2 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106488
AA Change: F552S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102097
Gene: ENSMUSG00000035064
AA Change: F552S

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106489
AA Change: F552S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102098
Gene: ENSMUSG00000035064
AA Change: F552S

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146482
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired regulation of ovarian follicular degeneration and apoptosis, prolonged estrus, and increased ovarian follicle numbers in aged females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A G 16: 13,677,223 D62G probably benign Het
6430548M08Rik G A 8: 120,145,641 V103I possibly damaging Het
Aatk T C 11: 120,011,383 E729G possibly damaging Het
Acaa2 A G 18: 74,799,159 T290A probably benign Het
Acaca C T 11: 84,293,016 T1240I probably benign Het
Adgre1 A G 17: 57,411,083 N365S probably benign Het
Adipor1 A G 1: 134,424,815 D108G probably damaging Het
Aebp2 A G 6: 140,648,010 Q462R probably damaging Het
Arhgef4 A G 1: 34,722,664 T334A unknown Het
Art5 T C 7: 102,097,205 E280G probably benign Het
BC067074 T C 13: 113,319,969 S850P Het
Bloc1s3 A G 7: 19,507,532 S24P possibly damaging Het
C2 T A 17: 34,862,982 N720I possibly damaging Het
Caprin2 T C 6: 148,842,834 D1031G probably damaging Het
Catsper1 A G 19: 5,337,757 T355A probably benign Het
Cd19 T A 7: 126,410,885 E398D possibly damaging Het
Cdca8 T C 4: 124,936,591 E31G probably damaging Het
Ceacam5 G A 7: 17,759,595 V848M probably damaging Het
Chd8 A T 14: 52,219,598 L971Q probably damaging Het
Ciao1 G A 2: 127,245,764 T217I probably damaging Het
Cldn1 A T 16: 26,363,174 I95N probably damaging Het
Clip2 C T 5: 134,504,762 R487Q probably benign Het
Cluh C T 11: 74,667,946 R1253C possibly damaging Het
Cngb3 A T 4: 19,505,187 Q640L probably benign Het
Cyp2c40 A T 19: 39,777,999 V384D probably damaging Het
Cyp2d26 T A 15: 82,790,471 M437L probably benign Het
D430041D05Rik A G 2: 104,256,844 S596P probably benign Het
Dagla A T 19: 10,255,689 V448D probably damaging Het
Ddx59 A T 1: 136,416,856 E88D probably benign Het
Dock1 T A 7: 134,782,412 F671I possibly damaging Het
Dtna T A 18: 23,631,397 V541D probably damaging Het
Erbb2 T C 11: 98,420,920 V94A possibly damaging Het
Etl4 A T 2: 20,766,534 I607F possibly damaging Het
Ets2 G T 16: 95,715,077 E234* probably null Het
Fbp1 A C 13: 62,871,209 V175G probably damaging Het
Fmn2 C T 1: 174,608,628 Q722* probably null Het
Fnip1 G T 11: 54,490,887 R288L probably benign Het
Ghr G A 15: 3,333,511 P160S probably damaging Het
Glipr1 A G 10: 111,996,896 S46P probably damaging Het
Gm4869 A T 5: 140,469,706 T356S probably benign Het
Kif9 G A 9: 110,517,642 R616H probably benign Het
Krt87 G T 15: 101,438,603 C56* probably null Het
Ldlr A G 9: 21,735,330 D264G probably damaging Het
Lrrk2 A T 15: 91,737,217 D998V probably benign Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mrc1 A G 2: 14,319,299 N1149S probably benign Het
Myo1c T A 11: 75,669,073 V661E probably benign Het
N4bp2 T C 5: 65,806,536 S643P probably benign Het
Nbl1 T A 4: 139,085,297 T75S probably benign Het
Ndn C T 7: 62,348,589 P61L possibly damaging Het
Nqo2 T A 13: 33,972,378 V25E possibly damaging Het
Olfr110 T A 17: 37,499,440 I263N probably damaging Het
Olfr1148 T G 2: 87,833,134 F32V probably benign Het
Olfr870 A G 9: 20,170,797 V258A probably damaging Het
Oma1 G T 4: 103,353,529 V411L possibly damaging Het
Osgin2 G T 4: 15,998,427 H398Q probably damaging Het
Pepd A C 7: 35,043,793 D419A probably benign Het
Pikfyve A T 1: 65,264,402 S1694C probably benign Het
Pirb G A 7: 3,717,618 R294C possibly damaging Het
Plec A T 15: 76,181,013 L1619Q unknown Het
Polq A G 16: 37,022,811 I236V probably benign Het
Prkag3 T G 1: 74,747,219 Q189P probably damaging Het
Prkcg A T 7: 3,310,844 M136L probably benign Het
Ptprn2 T C 12: 117,161,658 L604P probably benign Het
Rab6b A T 9: 103,140,402 T31S probably benign Het
Rnf213 A G 11: 119,469,053 N4424S Het
Ryr3 A T 2: 112,661,621 L3795Q probably damaging Het
Scg2 A G 1: 79,435,219 Y556H probably damaging Het
Serpina3j A G 12: 104,319,834 N416S probably damaging Het
Sik3 T A 9: 46,208,819 H735Q probably benign Het
Slain1 A C 14: 103,664,676 T60P Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc46a2 A T 4: 59,914,056 V289E probably damaging Het
Sorcs3 A T 19: 48,722,925 Y643F probably damaging Het
Sox30 A G 11: 45,984,813 N464S possibly damaging Het
Spata5 C T 3: 37,451,781 P670S probably damaging Het
Spta1 A G 1: 174,208,314 Y1062C probably damaging Het
Srrm3 A G 5: 135,852,251 D135G probably damaging Het
Stat5b T A 11: 100,808,450 H25L possibly damaging Het
Synj2 A G 17: 6,013,519 I513V probably benign Het
Syt11 T A 3: 88,762,018 Q189L probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Traf3ip2 T A 10: 39,645,776 D443E probably benign Het
Traf6 G T 2: 101,694,280 C235F probably damaging Het
Treh A G 9: 44,681,119 D47G probably damaging Het
Trpc4 C A 3: 54,318,129 H966Q probably benign Het
Ttbk1 A T 17: 46,473,590 D316E possibly damaging Het
Txndc16 A T 14: 45,205,342 F132Y probably damaging Het
Uggt1 A T 1: 36,234,805 probably null Het
Usp25 A T 16: 77,077,158 I541F probably damaging Het
Xirp1 A T 9: 120,018,208 D536E possibly damaging Het
Zfp51 A G 17: 21,464,029 E302G probably damaging Het
Zfp648 A T 1: 154,204,364 T90S probably benign Het
Zfp84 A G 7: 29,776,839 T319A possibly damaging Het
Other mutations in Eef2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Eef2k APN 7 120884815 unclassified probably benign
IGL01481:Eef2k APN 7 120895218 missense probably benign 0.23
IGL01935:Eef2k APN 7 120885831 missense probably damaging 1.00
IGL03109:Eef2k APN 7 120891726 missense probably damaging 1.00
R0458:Eef2k UTSW 7 120903290 missense probably damaging 0.99
R1639:Eef2k UTSW 7 120885828 missense probably damaging 1.00
R1986:Eef2k UTSW 7 120873346 missense possibly damaging 0.92
R3419:Eef2k UTSW 7 120885870 missense probably damaging 0.99
R3610:Eef2k UTSW 7 120889235 missense probably benign
R3707:Eef2k UTSW 7 120884712 missense probably damaging 1.00
R3856:Eef2k UTSW 7 120899371 nonsense probably null
R4024:Eef2k UTSW 7 120858598 missense probably benign 0.01
R4535:Eef2k UTSW 7 120858599 nonsense probably null
R4885:Eef2k UTSW 7 120891932 missense probably benign
R5137:Eef2k UTSW 7 120885422 missense probably damaging 0.99
R5137:Eef2k UTSW 7 120885423 missense probably damaging 1.00
R5501:Eef2k UTSW 7 120889248 missense probably benign 0.00
R5610:Eef2k UTSW 7 120886782 missense probably benign 0.00
R5633:Eef2k UTSW 7 120873290 intron probably benign
R7002:Eef2k UTSW 7 120891932 missense probably benign
R7166:Eef2k UTSW 7 120884772 missense probably damaging 1.00
R7254:Eef2k UTSW 7 120889265 missense probably benign 0.11
R7466:Eef2k UTSW 7 120903484 splice site probably null
R7486:Eef2k UTSW 7 120858570 missense probably benign
R7538:Eef2k UTSW 7 120891992 missense probably benign 0.29
R7593:Eef2k UTSW 7 120889268 critical splice donor site probably null
R7675:Eef2k UTSW 7 120858504 missense probably benign
R7815:Eef2k UTSW 7 120858570 missense probably benign
R7898:Eef2k UTSW 7 120895218 missense probably damaging 1.00
R8182:Eef2k UTSW 7 120873403 missense probably damaging 1.00
R8288:Eef2k UTSW 7 120903381 missense probably damaging 1.00
R8495:Eef2k UTSW 7 120887880 missense probably benign 0.00
R8807:Eef2k UTSW 7 120891707 missense possibly damaging 0.69
R8881:Eef2k UTSW 7 120873325 missense probably damaging 1.00
R8949:Eef2k UTSW 7 120891988 missense probably damaging 0.99
R9044:Eef2k UTSW 7 120880361 missense probably damaging 1.00
R9074:Eef2k UTSW 7 120891901 missense probably damaging 1.00
R9332:Eef2k UTSW 7 120884695 missense probably benign 0.00
R9445:Eef2k UTSW 7 120858471 missense probably benign
R9777:Eef2k UTSW 7 120900230 critical splice acceptor site probably benign
Z1177:Eef2k UTSW 7 120858453 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAAATCGGGAAGTCTGTTTTGGG -3'
(R):5'- TGGGTGGTAAGCGATGGAC -3'

Sequencing Primer
(F):5'- GTGATGCCCATTCCTGAGC -3'
(R):5'- ATGGACTGGTGAGCCCTTTC -3'
Posted On 2022-10-06