Incidental Mutation 'R9605:Acaca'
ID 726448
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Name acetyl-Coenzyme A carboxylase alpha
Synonyms LOC327983, Acac, A530025K05Rik, acetyl-CoA carboxylase, Acc1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9605 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84129672-84401651 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84293016 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1240 (T1240I)
Ref Sequence ENSEMBL: ENSMUSP00000020843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201] [ENSMUST00000183887]
AlphaFold Q5SWU9
Predicted Effect probably benign
Transcript: ENSMUST00000020843
AA Change: T1240I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: T1240I

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103201
AA Change: T1240I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: T1240I

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183887
AA Change: T61I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139378
Gene: ENSMUSG00000020532
AA Change: T61I

DomainStartEndE-ValueType
Pfam:ACC_central 1 228 8.6e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A G 16: 13,677,223 D62G probably benign Het
6430548M08Rik G A 8: 120,145,641 V103I possibly damaging Het
Aatk T C 11: 120,011,383 E729G possibly damaging Het
Acaa2 A G 18: 74,799,159 T290A probably benign Het
Adgre1 A G 17: 57,411,083 N365S probably benign Het
Adipor1 A G 1: 134,424,815 D108G probably damaging Het
Aebp2 A G 6: 140,648,010 Q462R probably damaging Het
Arhgef4 A G 1: 34,722,664 T334A unknown Het
Art5 T C 7: 102,097,205 E280G probably benign Het
BC067074 T C 13: 113,319,969 S850P Het
Bloc1s3 A G 7: 19,507,532 S24P possibly damaging Het
C2 T A 17: 34,862,982 N720I possibly damaging Het
Caprin2 T C 6: 148,842,834 D1031G probably damaging Het
Catsper1 A G 19: 5,337,757 T355A probably benign Het
Cd19 T A 7: 126,410,885 E398D possibly damaging Het
Cdca8 T C 4: 124,936,591 E31G probably damaging Het
Ceacam5 G A 7: 17,759,595 V848M probably damaging Het
Chd8 A T 14: 52,219,598 L971Q probably damaging Het
Ciao1 G A 2: 127,245,764 T217I probably damaging Het
Cldn1 A T 16: 26,363,174 I95N probably damaging Het
Clip2 C T 5: 134,504,762 R487Q probably benign Het
Cluh C T 11: 74,667,946 R1253C possibly damaging Het
Cngb3 A T 4: 19,505,187 Q640L probably benign Het
Cyp2c40 A T 19: 39,777,999 V384D probably damaging Het
Cyp2d26 T A 15: 82,790,471 M437L probably benign Het
D430041D05Rik A G 2: 104,256,844 S596P probably benign Het
Dagla A T 19: 10,255,689 V448D probably damaging Het
Ddx59 A T 1: 136,416,856 E88D probably benign Het
Dock1 T A 7: 134,782,412 F671I possibly damaging Het
Dtna T A 18: 23,631,397 V541D probably damaging Het
Eef2k T C 7: 120,891,947 F552S probably damaging Het
Erbb2 T C 11: 98,420,920 V94A possibly damaging Het
Etl4 A T 2: 20,766,534 I607F possibly damaging Het
Ets2 G T 16: 95,715,077 E234* probably null Het
Fbp1 A C 13: 62,871,209 V175G probably damaging Het
Fmn2 C T 1: 174,608,628 Q722* probably null Het
Fnip1 G T 11: 54,490,887 R288L probably benign Het
Ghr G A 15: 3,333,511 P160S probably damaging Het
Glipr1 A G 10: 111,996,896 S46P probably damaging Het
Gm4869 A T 5: 140,469,706 T356S probably benign Het
Kif9 G A 9: 110,517,642 R616H probably benign Het
Krt87 G T 15: 101,438,603 C56* probably null Het
Ldlr A G 9: 21,735,330 D264G probably damaging Het
Lrrk2 A T 15: 91,737,217 D998V probably benign Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mrc1 A G 2: 14,319,299 N1149S probably benign Het
Myo1c T A 11: 75,669,073 V661E probably benign Het
N4bp2 T C 5: 65,806,536 S643P probably benign Het
Nbl1 T A 4: 139,085,297 T75S probably benign Het
Ndn C T 7: 62,348,589 P61L possibly damaging Het
Nqo2 T A 13: 33,972,378 V25E possibly damaging Het
Olfr110 T A 17: 37,499,440 I263N probably damaging Het
Olfr1148 T G 2: 87,833,134 F32V probably benign Het
Olfr870 A G 9: 20,170,797 V258A probably damaging Het
Oma1 G T 4: 103,353,529 V411L possibly damaging Het
Osgin2 G T 4: 15,998,427 H398Q probably damaging Het
Pepd A C 7: 35,043,793 D419A probably benign Het
Pikfyve A T 1: 65,264,402 S1694C probably benign Het
Pirb G A 7: 3,717,618 R294C possibly damaging Het
Plec A T 15: 76,181,013 L1619Q unknown Het
Polq A G 16: 37,022,811 I236V probably benign Het
Prkag3 T G 1: 74,747,219 Q189P probably damaging Het
Prkcg A T 7: 3,310,844 M136L probably benign Het
Ptprn2 T C 12: 117,161,658 L604P probably benign Het
Rab6b A T 9: 103,140,402 T31S probably benign Het
Rnf213 A G 11: 119,469,053 N4424S Het
Ryr3 A T 2: 112,661,621 L3795Q probably damaging Het
Scg2 A G 1: 79,435,219 Y556H probably damaging Het
Serpina3j A G 12: 104,319,834 N416S probably damaging Het
Sik3 T A 9: 46,208,819 H735Q probably benign Het
Slain1 A C 14: 103,664,676 T60P Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc46a2 A T 4: 59,914,056 V289E probably damaging Het
Sorcs3 A T 19: 48,722,925 Y643F probably damaging Het
Sox30 A G 11: 45,984,813 N464S possibly damaging Het
Spata5 C T 3: 37,451,781 P670S probably damaging Het
Spta1 A G 1: 174,208,314 Y1062C probably damaging Het
Srrm3 A G 5: 135,852,251 D135G probably damaging Het
Stat5b T A 11: 100,808,450 H25L possibly damaging Het
Synj2 A G 17: 6,013,519 I513V probably benign Het
Syt11 T A 3: 88,762,018 Q189L probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Traf3ip2 T A 10: 39,645,776 D443E probably benign Het
Traf6 G T 2: 101,694,280 C235F probably damaging Het
Treh A G 9: 44,681,119 D47G probably damaging Het
Trpc4 C A 3: 54,318,129 H966Q probably benign Het
Ttbk1 A T 17: 46,473,590 D316E possibly damaging Het
Txndc16 A T 14: 45,205,342 F132Y probably damaging Het
Uggt1 A T 1: 36,234,805 probably null Het
Usp25 A T 16: 77,077,158 I541F probably damaging Het
Xirp1 A T 9: 120,018,208 D536E possibly damaging Het
Zfp51 A G 17: 21,464,029 E302G probably damaging Het
Zfp648 A T 1: 154,204,364 T90S probably benign Het
Zfp84 A G 7: 29,776,839 T319A possibly damaging Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84278917 missense probably damaging 1.00
IGL01134:Acaca APN 11 84251279 missense probably benign 0.22
IGL01446:Acaca APN 11 84260631 missense probably damaging 1.00
IGL01591:Acaca APN 11 84243320 missense probably damaging 1.00
IGL01663:Acaca APN 11 84277802 missense possibly damaging 0.85
IGL01767:Acaca APN 11 84320542 missense probably benign 0.01
IGL02206:Acaca APN 11 84260747 nonsense probably null
IGL02335:Acaca APN 11 84214258 missense possibly damaging 0.84
IGL02477:Acaca APN 11 84307168 splice site probably benign
IGL02515:Acaca APN 11 84262403 missense probably benign
IGL02651:Acaca APN 11 84245204 splice site probably benign
IGL02805:Acaca APN 11 84223133 splice site probably benign
IGL03328:Acaca APN 11 84320529 missense probably benign 0.00
effervescence UTSW 11 84262474 missense probably benign 0.41
fizz UTSW 11 84245856 missense probably damaging 0.98
greenhouse UTSW 11 84338356 missense probably damaging 1.00
Serene UTSW 11 84311409 splice site probably null
Tranquil UTSW 11 84280461 missense probably damaging 1.00
vitamin UTSW 11 84280435 missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84315852 missense probably damaging 1.00
R0385:Acaca UTSW 11 84231748 missense probably benign 0.01
R0518:Acaca UTSW 11 84290286 critical splice acceptor site probably null
R0536:Acaca UTSW 11 84280516 splice site probably benign
R0962:Acaca UTSW 11 84311303 missense probably damaging 1.00
R0968:Acaca UTSW 11 84239033 nonsense probably null
R1123:Acaca UTSW 11 84264080 missense probably benign 0.09
R1452:Acaca UTSW 11 84295059 splice site probably benign
R1478:Acaca UTSW 11 84372627 missense probably damaging 1.00
R1500:Acaca UTSW 11 84293984 missense probably benign 0.00
R1512:Acaca UTSW 11 84195469 missense probably benign 0.00
R1657:Acaca UTSW 11 84264084 missense probably benign 0.09
R1681:Acaca UTSW 11 84226185 missense probably damaging 1.00
R1682:Acaca UTSW 11 84392217 missense probably benign 0.23
R1688:Acaca UTSW 11 84238896 missense probably damaging 1.00
R1755:Acaca UTSW 11 84276564 frame shift probably null
R1775:Acaca UTSW 11 84300422 missense possibly damaging 0.56
R1793:Acaca UTSW 11 84315969 missense probably damaging 0.98
R1793:Acaca UTSW 11 84338393 missense probably damaging 1.00
R1855:Acaca UTSW 11 84371554 missense probably damaging 0.96
R1881:Acaca UTSW 11 84270387 nonsense probably null
R1881:Acaca UTSW 11 84300471 splice site probably benign
R1989:Acaca UTSW 11 84262529 missense probably damaging 0.98
R2147:Acaca UTSW 11 84276536 missense probably benign 0.03
R2215:Acaca UTSW 11 84363793 missense probably damaging 1.00
R2238:Acaca UTSW 11 84391505 splice site probably benign
R2252:Acaca UTSW 11 84371532 missense probably damaging 0.99
R2316:Acaca UTSW 11 84264080 missense probably benign 0.16
R2316:Acaca UTSW 11 84294983 missense possibly damaging 0.69
R2337:Acaca UTSW 11 84257197 missense possibly damaging 0.93
R2697:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3551:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3552:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3748:Acaca UTSW 11 84311409 splice site probably null
R3844:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3873:Acaca UTSW 11 84312721 unclassified probably benign
R4152:Acaca UTSW 11 84292926 missense possibly damaging 0.88
R4406:Acaca UTSW 11 84280449 missense probably benign 0.35
R4448:Acaca UTSW 11 84262492 missense probably damaging 1.00
R4642:Acaca UTSW 11 84280461 missense probably damaging 1.00
R4696:Acaca UTSW 11 84280435 missense possibly damaging 0.78
R4707:Acaca UTSW 11 84312854 missense probably damaging 0.96
R4710:Acaca UTSW 11 84392337 missense possibly damaging 0.84
R4775:Acaca UTSW 11 84243339 missense probably damaging 1.00
R4821:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R4883:Acaca UTSW 11 84251290 missense probably benign 0.01
R4988:Acaca UTSW 11 84263295 missense probably damaging 1.00
R5034:Acaca UTSW 11 84245264 missense probably benign 0.00
R5255:Acaca UTSW 11 84311307 missense probably damaging 1.00
R5294:Acaca UTSW 11 84391519 missense probably benign 0.01
R5350:Acaca UTSW 11 84215873 missense probably damaging 0.99
R5437:Acaca UTSW 11 84346820 splice site probably null
R5664:Acaca UTSW 11 84243384 missense probably damaging 1.00
R5665:Acaca UTSW 11 84245294 nonsense probably null
R5959:Acaca UTSW 11 84215966 missense probably damaging 1.00
R6011:Acaca UTSW 11 84245744 missense probably benign 0.44
R6027:Acaca UTSW 11 84398177 missense probably benign
R6246:Acaca UTSW 11 84315970 missense probably benign 0.08
R6313:Acaca UTSW 11 84292929 missense probably benign 0.00
R6450:Acaca UTSW 11 84280468 missense probably damaging 0.98
R6623:Acaca UTSW 11 84371499 critical splice acceptor site probably null
R6736:Acaca UTSW 11 84238838 missense probably benign 0.05
R6752:Acaca UTSW 11 84195483 missense probably benign 0.44
R6807:Acaca UTSW 11 84391530 missense probably benign
R6826:Acaca UTSW 11 84195536 missense probably damaging 1.00
R7035:Acaca UTSW 11 84238943 missense probably damaging 1.00
R7078:Acaca UTSW 11 84263312 missense possibly damaging 0.91
R7088:Acaca UTSW 11 84278957 critical splice donor site probably null
R7201:Acaca UTSW 11 84262474 missense probably benign 0.41
R7261:Acaca UTSW 11 84368700 missense probably damaging 1.00
R7399:Acaca UTSW 11 84260679 missense possibly damaging 0.89
R7421:Acaca UTSW 11 84363736 missense possibly damaging 0.64
R7443:Acaca UTSW 11 84315793 missense probably benign 0.02
R7453:Acaca UTSW 11 84245310 missense probably benign
R7471:Acaca UTSW 11 84277782 splice site probably null
R7519:Acaca UTSW 11 84245856 missense probably damaging 0.98
R7537:Acaca UTSW 11 84260634 missense probably damaging 1.00
R7574:Acaca UTSW 11 84261588 missense probably benign
R7633:Acaca UTSW 11 84372639 missense probably benign 0.26
R7643:Acaca UTSW 11 84338356 missense probably damaging 1.00
R7664:Acaca UTSW 11 84245349 missense probably damaging 1.00
R7675:Acaca UTSW 11 84315916 missense probably benign 0.04
R7676:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R7729:Acaca UTSW 11 84371513 missense probably damaging 0.98
R7867:Acaca UTSW 11 84249524 missense possibly damaging 0.88
R7898:Acaca UTSW 11 84364449 critical splice donor site probably null
R7909:Acaca UTSW 11 84245235 missense possibly damaging 0.56
R7915:Acaca UTSW 11 84276588 missense probably benign
R7956:Acaca UTSW 11 84320580 missense probably damaging 0.98
R8000:Acaca UTSW 11 84392231 missense possibly damaging 0.88
R8038:Acaca UTSW 11 84215904 missense probably damaging 1.00
R8545:Acaca UTSW 11 84345968 missense probably damaging 1.00
R8722:Acaca UTSW 11 84338457 missense possibly damaging 0.85
R9005:Acaca UTSW 11 84371584 missense probably damaging 0.99
R9130:Acaca UTSW 11 84311319 missense probably damaging 1.00
R9397:Acaca UTSW 11 84368725 missense probably damaging 1.00
R9489:Acaca UTSW 11 84293016 missense probably benign 0.01
R9540:Acaca UTSW 11 84243411 missense probably damaging 1.00
R9593:Acaca UTSW 11 84380513 nonsense probably null
R9634:Acaca UTSW 11 84293990 missense probably benign 0.00
R9720:Acaca UTSW 11 84263357 missense probably damaging 1.00
RF014:Acaca UTSW 11 84231724 missense probably benign 0.01
X0027:Acaca UTSW 11 84292895 missense probably benign 0.01
X0060:Acaca UTSW 11 84264104 missense probably benign
X0067:Acaca UTSW 11 84368737 nonsense probably null
Z1176:Acaca UTSW 11 84260720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATCTGCTCTGCAACCTGAC -3'
(R):5'- AAGCTGTATCTCTCTGGCTACC -3'

Sequencing Primer
(F):5'- GACCCCACATGACCGTTTTC -3'
(R):5'- GCTGTATCTCTCTGGCTACCTCATAG -3'
Posted On 2022-10-06