Incidental Mutation 'R9605:Ptprn2'
ID 726454
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R9605 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 117125278 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 604 (L604P)
Ref Sequence ENSEMBL: ENSMUSP00000064046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably benign
Transcript: ENSMUST00000070733
AA Change: L604P

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: L604P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190247
AA Change: L604P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: L604P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,872,380 (GRCm39) V103I possibly damaging Het
Aatk T C 11: 119,902,209 (GRCm39) E729G possibly damaging Het
Acaa2 A G 18: 74,932,230 (GRCm39) T290A probably benign Het
Acaca C T 11: 84,183,842 (GRCm39) T1240I probably benign Het
Adgre1 A G 17: 57,718,083 (GRCm39) N365S probably benign Het
Adipor1 A G 1: 134,352,553 (GRCm39) D108G probably damaging Het
Aebp2 A G 6: 140,593,736 (GRCm39) Q462R probably damaging Het
Afg2a C T 3: 37,505,930 (GRCm39) P670S probably damaging Het
Arhgef4 A G 1: 34,761,745 (GRCm39) T334A unknown Het
Art5 T C 7: 101,746,412 (GRCm39) E280G probably benign Het
Bloc1s3 A G 7: 19,241,457 (GRCm39) S24P possibly damaging Het
C2 T A 17: 35,081,958 (GRCm39) N720I possibly damaging Het
Caprin2 T C 6: 148,744,332 (GRCm39) D1031G probably damaging Het
Catsper1 A G 19: 5,387,785 (GRCm39) T355A probably benign Het
Cd19 T A 7: 126,010,057 (GRCm39) E398D possibly damaging Het
Cdca8 T C 4: 124,830,384 (GRCm39) E31G probably damaging Het
Ceacam5 G A 7: 17,493,520 (GRCm39) V848M probably damaging Het
Chd8 A T 14: 52,457,055 (GRCm39) L971Q probably damaging Het
Ciao1 G A 2: 127,087,684 (GRCm39) T217I probably damaging Het
Cldn1 A T 16: 26,181,924 (GRCm39) I95N probably damaging Het
Clip2 C T 5: 134,533,616 (GRCm39) R487Q probably benign Het
Cluh C T 11: 74,558,772 (GRCm39) R1253C possibly damaging Het
Cngb3 A T 4: 19,505,187 (GRCm39) Q640L probably benign Het
Cspg4b T C 13: 113,456,503 (GRCm39) S850P Het
Cyp2c40 A T 19: 39,766,443 (GRCm39) V384D probably damaging Het
Cyp2d26 T A 15: 82,674,672 (GRCm39) M437L probably benign Het
D430041D05Rik A G 2: 104,087,189 (GRCm39) S596P probably benign Het
Dagla A T 19: 10,233,053 (GRCm39) V448D probably damaging Het
Ddx59 A T 1: 136,344,594 (GRCm39) E88D probably benign Het
Dock1 T A 7: 134,384,141 (GRCm39) F671I possibly damaging Het
Dtna T A 18: 23,764,454 (GRCm39) V541D probably damaging Het
Eef2k T C 7: 120,491,170 (GRCm39) F552S probably damaging Het
Erbb2 T C 11: 98,311,746 (GRCm39) V94A possibly damaging Het
Etl4 A T 2: 20,771,345 (GRCm39) I607F possibly damaging Het
Ets2 G T 16: 95,516,121 (GRCm39) E234* probably null Het
Fbp1 A C 13: 63,019,023 (GRCm39) V175G probably damaging Het
Fmn2 C T 1: 174,436,194 (GRCm39) Q722* probably null Het
Fnip1 G T 11: 54,381,713 (GRCm39) R288L probably benign Het
Ghr G A 15: 3,362,993 (GRCm39) P160S probably damaging Het
Glipr1 A G 10: 111,832,801 (GRCm39) S46P probably damaging Het
Kif19b A T 5: 140,455,461 (GRCm39) T356S probably benign Het
Kif9 G A 9: 110,346,710 (GRCm39) R616H probably benign Het
Krt87 G T 15: 101,336,484 (GRCm39) C56* probably null Het
Ldlr A G 9: 21,646,626 (GRCm39) D264G probably damaging Het
Lrrk2 A T 15: 91,621,420 (GRCm39) D998V probably benign Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mrc1 A G 2: 14,324,110 (GRCm39) N1149S probably benign Het
Myo1c T A 11: 75,559,899 (GRCm39) V661E probably benign Het
N4bp2 T C 5: 65,963,879 (GRCm39) S643P probably benign Het
Nbl1 T A 4: 138,812,608 (GRCm39) T75S probably benign Het
Ndn C T 7: 61,998,337 (GRCm39) P61L possibly damaging Het
Nqo2 T A 13: 34,156,361 (GRCm39) V25E possibly damaging Het
Oma1 G T 4: 103,210,726 (GRCm39) V411L possibly damaging Het
Or12e13 T G 2: 87,663,478 (GRCm39) F32V probably benign Het
Or5v1 T A 17: 37,810,331 (GRCm39) I263N probably damaging Het
Or8b12i A G 9: 20,082,093 (GRCm39) V258A probably damaging Het
Osgin2 G T 4: 15,998,427 (GRCm39) H398Q probably damaging Het
Pepd A C 7: 34,743,218 (GRCm39) D419A probably benign Het
Pikfyve A T 1: 65,303,561 (GRCm39) S1694C probably benign Het
Pirb G A 7: 3,720,617 (GRCm39) R294C possibly damaging Het
Plec A T 15: 76,065,213 (GRCm39) L1619Q unknown Het
Polq A G 16: 36,843,173 (GRCm39) I236V probably benign Het
Pphln1-ps1 A G 16: 13,495,087 (GRCm39) D62G probably benign Het
Prkag3 T G 1: 74,786,378 (GRCm39) Q189P probably damaging Het
Prkcg A T 7: 3,359,360 (GRCm39) M136L probably benign Het
Rab6b A T 9: 103,017,601 (GRCm39) T31S probably benign Het
Rnf213 A G 11: 119,359,879 (GRCm39) N4424S Het
Ryr3 A T 2: 112,491,966 (GRCm39) L3795Q probably damaging Het
Scg2 A G 1: 79,412,936 (GRCm39) Y556H probably damaging Het
Serpina3j A G 12: 104,286,093 (GRCm39) N416S probably damaging Het
Sik3 T A 9: 46,120,117 (GRCm39) H735Q probably benign Het
Slain1 A C 14: 103,902,112 (GRCm39) T60P Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc46a2 A T 4: 59,914,056 (GRCm39) V289E probably damaging Het
Sorcs3 A T 19: 48,711,364 (GRCm39) Y643F probably damaging Het
Sox30 A G 11: 45,875,640 (GRCm39) N464S possibly damaging Het
Spta1 A G 1: 174,035,880 (GRCm39) Y1062C probably damaging Het
Srrm3 A G 5: 135,881,105 (GRCm39) D135G probably damaging Het
Stat5b T A 11: 100,699,276 (GRCm39) H25L possibly damaging Het
Synj2 A G 17: 6,063,794 (GRCm39) I513V probably benign Het
Syt11 T A 3: 88,669,325 (GRCm39) Q189L probably benign Het
Tbc1d1 G A 5: 64,443,350 (GRCm39) R523Q probably damaging Het
Traf3ip2 T A 10: 39,521,772 (GRCm39) D443E probably benign Het
Traf6 G T 2: 101,524,625 (GRCm39) C235F probably damaging Het
Treh A G 9: 44,592,416 (GRCm39) D47G probably damaging Het
Trpc4 C A 3: 54,225,550 (GRCm39) H966Q probably benign Het
Ttbk1 A T 17: 46,784,516 (GRCm39) D316E possibly damaging Het
Txndc16 A T 14: 45,442,799 (GRCm39) F132Y probably damaging Het
Uggt1 A T 1: 36,273,886 (GRCm39) probably null Het
Usp25 A T 16: 76,874,046 (GRCm39) I541F probably damaging Het
Xirp1 A T 9: 119,847,274 (GRCm39) D536E possibly damaging Het
Zfp51 A G 17: 21,684,291 (GRCm39) E302G probably damaging Het
Zfp648 A T 1: 154,080,110 (GRCm39) T90S probably benign Het
Zfp84 A G 7: 29,476,264 (GRCm39) T319A possibly damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117,212,308 (GRCm39) missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1443:Ptprn2 UTSW 12 117,217,235 (GRCm39) missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117,148,342 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116,544,048 (GRCm39) missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117,211,337 (GRCm39) missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117,196,985 (GRCm39) splice site probably null
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117,175,482 (GRCm39) missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117,148,267 (GRCm39) missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116,822,739 (GRCm39) missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117,190,820 (GRCm39) missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117,190,845 (GRCm39) splice site probably null
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116,822,571 (GRCm39) missense probably benign
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTCTTTGCACGTGTGTC -3'
(R):5'- CTCTCAAATCAAGTTTGGCAAATCC -3'

Sequencing Primer
(F):5'- TGTGTCCCTGCACAGCC -3'
(R):5'- TGGCAAATCCAAGGAGAAAACTTTG -3'
Posted On 2022-10-06