Incidental Mutation 'R9605:Ptprn2'
ID 726454
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase, receptor type, N polypeptide 2
Synonyms phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock # R9605 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 116485720-117276849 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 117161658 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 604 (L604P)
Ref Sequence ENSEMBL: ENSMUSP00000064046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably benign
Transcript: ENSMUST00000070733
AA Change: L604P

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: L604P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190247
AA Change: L604P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: L604P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A G 16: 13,677,223 D62G probably benign Het
6430548M08Rik G A 8: 120,145,641 V103I possibly damaging Het
Aatk T C 11: 120,011,383 E729G possibly damaging Het
Acaa2 A G 18: 74,799,159 T290A probably benign Het
Acaca C T 11: 84,293,016 T1240I probably benign Het
Adgre1 A G 17: 57,411,083 N365S probably benign Het
Adipor1 A G 1: 134,424,815 D108G probably damaging Het
Aebp2 A G 6: 140,648,010 Q462R probably damaging Het
Arhgef4 A G 1: 34,722,664 T334A unknown Het
Art5 T C 7: 102,097,205 E280G probably benign Het
BC067074 T C 13: 113,319,969 S850P Het
Bloc1s3 A G 7: 19,507,532 S24P possibly damaging Het
C2 T A 17: 34,862,982 N720I possibly damaging Het
Caprin2 T C 6: 148,842,834 D1031G probably damaging Het
Catsper1 A G 19: 5,337,757 T355A probably benign Het
Cd19 T A 7: 126,410,885 E398D possibly damaging Het
Cdca8 T C 4: 124,936,591 E31G probably damaging Het
Ceacam5 G A 7: 17,759,595 V848M probably damaging Het
Chd8 A T 14: 52,219,598 L971Q probably damaging Het
Ciao1 G A 2: 127,245,764 T217I probably damaging Het
Cldn1 A T 16: 26,363,174 I95N probably damaging Het
Clip2 C T 5: 134,504,762 R487Q probably benign Het
Cluh C T 11: 74,667,946 R1253C possibly damaging Het
Cngb3 A T 4: 19,505,187 Q640L probably benign Het
Cyp2c40 A T 19: 39,777,999 V384D probably damaging Het
Cyp2d26 T A 15: 82,790,471 M437L probably benign Het
D430041D05Rik A G 2: 104,256,844 S596P probably benign Het
Dagla A T 19: 10,255,689 V448D probably damaging Het
Ddx59 A T 1: 136,416,856 E88D probably benign Het
Dock1 T A 7: 134,782,412 F671I possibly damaging Het
Dtna T A 18: 23,631,397 V541D probably damaging Het
Eef2k T C 7: 120,891,947 F552S probably damaging Het
Erbb2 T C 11: 98,420,920 V94A possibly damaging Het
Etl4 A T 2: 20,766,534 I607F possibly damaging Het
Ets2 G T 16: 95,715,077 E234* probably null Het
Fbp1 A C 13: 62,871,209 V175G probably damaging Het
Fmn2 C T 1: 174,608,628 Q722* probably null Het
Fnip1 G T 11: 54,490,887 R288L probably benign Het
Ghr G A 15: 3,333,511 P160S probably damaging Het
Glipr1 A G 10: 111,996,896 S46P probably damaging Het
Gm4869 A T 5: 140,469,706 T356S probably benign Het
Kif9 G A 9: 110,517,642 R616H probably benign Het
Krt87 G T 15: 101,438,603 C56* probably null Het
Ldlr A G 9: 21,735,330 D264G probably damaging Het
Lrrk2 A T 15: 91,737,217 D998V probably benign Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mrc1 A G 2: 14,319,299 N1149S probably benign Het
Myo1c T A 11: 75,669,073 V661E probably benign Het
N4bp2 T C 5: 65,806,536 S643P probably benign Het
Nbl1 T A 4: 139,085,297 T75S probably benign Het
Ndn C T 7: 62,348,589 P61L possibly damaging Het
Nqo2 T A 13: 33,972,378 V25E possibly damaging Het
Olfr110 T A 17: 37,499,440 I263N probably damaging Het
Olfr1148 T G 2: 87,833,134 F32V probably benign Het
Olfr870 A G 9: 20,170,797 V258A probably damaging Het
Oma1 G T 4: 103,353,529 V411L possibly damaging Het
Osgin2 G T 4: 15,998,427 H398Q probably damaging Het
Pepd A C 7: 35,043,793 D419A probably benign Het
Pikfyve A T 1: 65,264,402 S1694C probably benign Het
Pirb G A 7: 3,717,618 R294C possibly damaging Het
Plec A T 15: 76,181,013 L1619Q unknown Het
Polq A G 16: 37,022,811 I236V probably benign Het
Prkag3 T G 1: 74,747,219 Q189P probably damaging Het
Prkcg A T 7: 3,310,844 M136L probably benign Het
Rab6b A T 9: 103,140,402 T31S probably benign Het
Rnf213 A G 11: 119,469,053 N4424S Het
Ryr3 A T 2: 112,661,621 L3795Q probably damaging Het
Scg2 A G 1: 79,435,219 Y556H probably damaging Het
Serpina3j A G 12: 104,319,834 N416S probably damaging Het
Sik3 T A 9: 46,208,819 H735Q probably benign Het
Slain1 A C 14: 103,664,676 T60P Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc46a2 A T 4: 59,914,056 V289E probably damaging Het
Sorcs3 A T 19: 48,722,925 Y643F probably damaging Het
Sox30 A G 11: 45,984,813 N464S possibly damaging Het
Spata5 C T 3: 37,451,781 P670S probably damaging Het
Spta1 A G 1: 174,208,314 Y1062C probably damaging Het
Srrm3 A G 5: 135,852,251 D135G probably damaging Het
Stat5b T A 11: 100,808,450 H25L possibly damaging Het
Synj2 A G 17: 6,013,519 I513V probably benign Het
Syt11 T A 3: 88,762,018 Q189L probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Traf3ip2 T A 10: 39,645,776 D443E probably benign Het
Traf6 G T 2: 101,694,280 C235F probably damaging Het
Treh A G 9: 44,681,119 D47G probably damaging Het
Trpc4 C A 3: 54,318,129 H966Q probably benign Het
Ttbk1 A T 17: 46,473,590 D316E possibly damaging Het
Txndc16 A T 14: 45,205,342 F132Y probably damaging Het
Uggt1 A T 1: 36,234,805 probably null Het
Usp25 A T 16: 77,077,158 I541F probably damaging Het
Xirp1 A T 9: 120,018,208 D536E possibly damaging Het
Zfp51 A G 17: 21,464,029 E302G probably damaging Het
Zfp648 A T 1: 154,204,364 T90S probably benign Het
Zfp84 A G 7: 29,776,839 T319A possibly damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116841388 missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116900987 missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116873697 splice site probably benign
IGL02339:Ptprn2 APN 12 116722104 missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116888898 missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117211943 missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116876344 nonsense probably null
BB001:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117248688 missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117211846 splice site probably benign
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117211846 splice site probably benign
R0694:Ptprn2 UTSW 12 116824355 missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116722130 nonsense probably null
R0746:Ptprn2 UTSW 12 116901017 missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117212008 splice site probably null
R1443:Ptprn2 UTSW 12 117253615 missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117184722 missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117161709 missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116722172 missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116580428 missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117247717 missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116722133 missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116888877 missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116901008 missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116876000 missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116872094 missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116824396 missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117247773 nonsense probably null
R4872:Ptprn2 UTSW 12 117161694 missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117233365 splice site probably null
R4970:Ptprn2 UTSW 12 117276595 missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116858928 missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117211862 missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117184647 missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116859119 missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117269589 missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116872038 missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117227200 missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116888888 missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116872056 missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117227225 splice site probably null
R7237:Ptprn2 UTSW 12 117161727 missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117248544 missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116858951 missense probably benign
R7460:Ptprn2 UTSW 12 117248681 missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116485866 start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116722119 missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116841320 missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117184737 missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117255548 missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117269651 critical splice donor site probably null
X0066:Ptprn2 UTSW 12 117161760 missense probably damaging 1.00
X0066:Ptprn2 UTSW 12 117184740 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AACTTCTTTGCACGTGTGTC -3'
(R):5'- CTCTCAAATCAAGTTTGGCAAATCC -3'

Sequencing Primer
(F):5'- TGTGTCCCTGCACAGCC -3'
(R):5'- TGGCAAATCCAAGGAGAAAACTTTG -3'
Posted On 2022-10-06