Incidental Mutation 'R9605:Dtna'
ID 726477
Institutional Source Beutler Lab
Gene Symbol Dtna
Ensembl Gene ENSMUSG00000024302
Gene Name dystrobrevin alpha
Synonyms a-DB-1, A0, alpha-dystrobrevin, 2210407P21Rik, 87K protein, Dtn, adbn
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R9605 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 23548192-23792772 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23764454 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 541 (V541D)
Ref Sequence ENSEMBL: ENSMUSP00000152288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115832] [ENSMUST00000220904] [ENSMUST00000221880]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000115832
AA Change: V484D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302
AA Change: V484D

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220904
AA Change: V541D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221880
AA Change: V541D

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutants exhibit skeletal and cardiac myopathies. Neuromuscular junctions appear to form normally, but their postnatal maturation is compromised. Dtna mutations do not increase the severity of Dmd or Utrn mutants whose products are also part of the dystrophin-glycoprotein complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,872,380 (GRCm39) V103I possibly damaging Het
Aatk T C 11: 119,902,209 (GRCm39) E729G possibly damaging Het
Acaa2 A G 18: 74,932,230 (GRCm39) T290A probably benign Het
Acaca C T 11: 84,183,842 (GRCm39) T1240I probably benign Het
Adgre1 A G 17: 57,718,083 (GRCm39) N365S probably benign Het
Adipor1 A G 1: 134,352,553 (GRCm39) D108G probably damaging Het
Aebp2 A G 6: 140,593,736 (GRCm39) Q462R probably damaging Het
Afg2a C T 3: 37,505,930 (GRCm39) P670S probably damaging Het
Arhgef4 A G 1: 34,761,745 (GRCm39) T334A unknown Het
Art5 T C 7: 101,746,412 (GRCm39) E280G probably benign Het
Bloc1s3 A G 7: 19,241,457 (GRCm39) S24P possibly damaging Het
C2 T A 17: 35,081,958 (GRCm39) N720I possibly damaging Het
Caprin2 T C 6: 148,744,332 (GRCm39) D1031G probably damaging Het
Catsper1 A G 19: 5,387,785 (GRCm39) T355A probably benign Het
Cd19 T A 7: 126,010,057 (GRCm39) E398D possibly damaging Het
Cdca8 T C 4: 124,830,384 (GRCm39) E31G probably damaging Het
Ceacam5 G A 7: 17,493,520 (GRCm39) V848M probably damaging Het
Chd8 A T 14: 52,457,055 (GRCm39) L971Q probably damaging Het
Ciao1 G A 2: 127,087,684 (GRCm39) T217I probably damaging Het
Cldn1 A T 16: 26,181,924 (GRCm39) I95N probably damaging Het
Clip2 C T 5: 134,533,616 (GRCm39) R487Q probably benign Het
Cluh C T 11: 74,558,772 (GRCm39) R1253C possibly damaging Het
Cngb3 A T 4: 19,505,187 (GRCm39) Q640L probably benign Het
Cspg4b T C 13: 113,456,503 (GRCm39) S850P Het
Cyp2c40 A T 19: 39,766,443 (GRCm39) V384D probably damaging Het
Cyp2d26 T A 15: 82,674,672 (GRCm39) M437L probably benign Het
D430041D05Rik A G 2: 104,087,189 (GRCm39) S596P probably benign Het
Dagla A T 19: 10,233,053 (GRCm39) V448D probably damaging Het
Ddx59 A T 1: 136,344,594 (GRCm39) E88D probably benign Het
Dock1 T A 7: 134,384,141 (GRCm39) F671I possibly damaging Het
Eef2k T C 7: 120,491,170 (GRCm39) F552S probably damaging Het
Erbb2 T C 11: 98,311,746 (GRCm39) V94A possibly damaging Het
Etl4 A T 2: 20,771,345 (GRCm39) I607F possibly damaging Het
Ets2 G T 16: 95,516,121 (GRCm39) E234* probably null Het
Fbp1 A C 13: 63,019,023 (GRCm39) V175G probably damaging Het
Fmn2 C T 1: 174,436,194 (GRCm39) Q722* probably null Het
Fnip1 G T 11: 54,381,713 (GRCm39) R288L probably benign Het
Ghr G A 15: 3,362,993 (GRCm39) P160S probably damaging Het
Glipr1 A G 10: 111,832,801 (GRCm39) S46P probably damaging Het
Kif19b A T 5: 140,455,461 (GRCm39) T356S probably benign Het
Kif9 G A 9: 110,346,710 (GRCm39) R616H probably benign Het
Krt87 G T 15: 101,336,484 (GRCm39) C56* probably null Het
Ldlr A G 9: 21,646,626 (GRCm39) D264G probably damaging Het
Lrrk2 A T 15: 91,621,420 (GRCm39) D998V probably benign Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mrc1 A G 2: 14,324,110 (GRCm39) N1149S probably benign Het
Myo1c T A 11: 75,559,899 (GRCm39) V661E probably benign Het
N4bp2 T C 5: 65,963,879 (GRCm39) S643P probably benign Het
Nbl1 T A 4: 138,812,608 (GRCm39) T75S probably benign Het
Ndn C T 7: 61,998,337 (GRCm39) P61L possibly damaging Het
Nqo2 T A 13: 34,156,361 (GRCm39) V25E possibly damaging Het
Oma1 G T 4: 103,210,726 (GRCm39) V411L possibly damaging Het
Or12e13 T G 2: 87,663,478 (GRCm39) F32V probably benign Het
Or5v1 T A 17: 37,810,331 (GRCm39) I263N probably damaging Het
Or8b12i A G 9: 20,082,093 (GRCm39) V258A probably damaging Het
Osgin2 G T 4: 15,998,427 (GRCm39) H398Q probably damaging Het
Pepd A C 7: 34,743,218 (GRCm39) D419A probably benign Het
Pikfyve A T 1: 65,303,561 (GRCm39) S1694C probably benign Het
Pirb G A 7: 3,720,617 (GRCm39) R294C possibly damaging Het
Plec A T 15: 76,065,213 (GRCm39) L1619Q unknown Het
Polq A G 16: 36,843,173 (GRCm39) I236V probably benign Het
Pphln1-ps1 A G 16: 13,495,087 (GRCm39) D62G probably benign Het
Prkag3 T G 1: 74,786,378 (GRCm39) Q189P probably damaging Het
Prkcg A T 7: 3,359,360 (GRCm39) M136L probably benign Het
Ptprn2 T C 12: 117,125,278 (GRCm39) L604P probably benign Het
Rab6b A T 9: 103,017,601 (GRCm39) T31S probably benign Het
Rnf213 A G 11: 119,359,879 (GRCm39) N4424S Het
Ryr3 A T 2: 112,491,966 (GRCm39) L3795Q probably damaging Het
Scg2 A G 1: 79,412,936 (GRCm39) Y556H probably damaging Het
Serpina3j A G 12: 104,286,093 (GRCm39) N416S probably damaging Het
Sik3 T A 9: 46,120,117 (GRCm39) H735Q probably benign Het
Slain1 A C 14: 103,902,112 (GRCm39) T60P Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc46a2 A T 4: 59,914,056 (GRCm39) V289E probably damaging Het
Sorcs3 A T 19: 48,711,364 (GRCm39) Y643F probably damaging Het
Sox30 A G 11: 45,875,640 (GRCm39) N464S possibly damaging Het
Spta1 A G 1: 174,035,880 (GRCm39) Y1062C probably damaging Het
Srrm3 A G 5: 135,881,105 (GRCm39) D135G probably damaging Het
Stat5b T A 11: 100,699,276 (GRCm39) H25L possibly damaging Het
Synj2 A G 17: 6,063,794 (GRCm39) I513V probably benign Het
Syt11 T A 3: 88,669,325 (GRCm39) Q189L probably benign Het
Tbc1d1 G A 5: 64,443,350 (GRCm39) R523Q probably damaging Het
Traf3ip2 T A 10: 39,521,772 (GRCm39) D443E probably benign Het
Traf6 G T 2: 101,524,625 (GRCm39) C235F probably damaging Het
Treh A G 9: 44,592,416 (GRCm39) D47G probably damaging Het
Trpc4 C A 3: 54,225,550 (GRCm39) H966Q probably benign Het
Ttbk1 A T 17: 46,784,516 (GRCm39) D316E possibly damaging Het
Txndc16 A T 14: 45,442,799 (GRCm39) F132Y probably damaging Het
Uggt1 A T 1: 36,273,886 (GRCm39) probably null Het
Usp25 A T 16: 76,874,046 (GRCm39) I541F probably damaging Het
Xirp1 A T 9: 119,847,274 (GRCm39) D536E possibly damaging Het
Zfp51 A G 17: 21,684,291 (GRCm39) E302G probably damaging Het
Zfp648 A T 1: 154,080,110 (GRCm39) T90S probably benign Het
Zfp84 A G 7: 29,476,264 (GRCm39) T319A possibly damaging Het
Other mutations in Dtna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Dtna APN 18 23,730,545 (GRCm39) missense probably benign 0.22
IGL01620:Dtna APN 18 23,758,144 (GRCm39) missense probably damaging 1.00
IGL01705:Dtna APN 18 23,678,788 (GRCm39) missense probably damaging 1.00
IGL01914:Dtna APN 18 23,730,516 (GRCm39) missense possibly damaging 0.62
IGL02388:Dtna APN 18 23,730,571 (GRCm39) missense probably benign 0.00
IGL02427:Dtna APN 18 23,784,595 (GRCm39) missense possibly damaging 0.95
IGL03074:Dtna APN 18 23,735,662 (GRCm39) missense possibly damaging 0.74
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0078:Dtna UTSW 18 23,754,499 (GRCm39) missense probably damaging 1.00
R0390:Dtna UTSW 18 23,730,558 (GRCm39) missense probably damaging 1.00
R1808:Dtna UTSW 18 23,702,697 (GRCm39) missense probably damaging 1.00
R1872:Dtna UTSW 18 23,730,617 (GRCm39) critical splice donor site probably null
R2095:Dtna UTSW 18 23,702,805 (GRCm39) missense probably damaging 1.00
R2216:Dtna UTSW 18 23,702,622 (GRCm39) missense probably damaging 1.00
R2295:Dtna UTSW 18 23,764,469 (GRCm39) missense probably damaging 1.00
R2402:Dtna UTSW 18 23,728,535 (GRCm39) nonsense probably null
R2846:Dtna UTSW 18 23,784,560 (GRCm39) splice site probably null
R3836:Dtna UTSW 18 23,758,159 (GRCm39) missense probably damaging 1.00
R4764:Dtna UTSW 18 23,668,206 (GRCm39) splice site probably null
R4893:Dtna UTSW 18 23,702,724 (GRCm39) missense probably damaging 0.99
R5194:Dtna UTSW 18 23,723,302 (GRCm39) nonsense probably null
R5373:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5374:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5526:Dtna UTSW 18 23,779,287 (GRCm39) missense probably damaging 0.99
R5755:Dtna UTSW 18 23,754,520 (GRCm39) missense probably benign
R5769:Dtna UTSW 18 23,784,611 (GRCm39) missense probably benign 0.27
R6062:Dtna UTSW 18 23,755,113 (GRCm39) missense possibly damaging 0.87
R6413:Dtna UTSW 18 23,755,071 (GRCm39) missense probably damaging 1.00
R6876:Dtna UTSW 18 23,744,167 (GRCm39) missense probably benign 0.00
R7103:Dtna UTSW 18 23,786,436 (GRCm39) critical splice donor site probably null
R7711:Dtna UTSW 18 23,758,253 (GRCm39) critical splice donor site probably null
R7804:Dtna UTSW 18 23,728,666 (GRCm39) missense probably damaging 0.97
R8156:Dtna UTSW 18 23,723,388 (GRCm39) nonsense probably null
R8437:Dtna UTSW 18 23,723,398 (GRCm39) nonsense probably null
R8786:Dtna UTSW 18 23,716,190 (GRCm39) missense probably benign 0.10
R9038:Dtna UTSW 18 23,743,553 (GRCm39) missense probably benign
R9268:Dtna UTSW 18 23,702,643 (GRCm39) missense possibly damaging 0.93
R9416:Dtna UTSW 18 23,780,112 (GRCm39) critical splice donor site probably null
R9578:Dtna UTSW 18 23,728,612 (GRCm39) missense probably damaging 0.98
R9638:Dtna UTSW 18 23,744,122 (GRCm39) missense probably benign
X0063:Dtna UTSW 18 23,776,225 (GRCm39) missense probably damaging 0.98
X0066:Dtna UTSW 18 23,726,038 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CACTTTAAGACAGTTACCTAGCTGG -3'
(R):5'- ACTGCTAGTCCTTCACAGGC -3'

Sequencing Primer
(F):5'- CCTAGCTGGTAACACTATTGAAGTC -3'
(R):5'- GCTAGTCCTTCACAGGCCTAAG -3'
Posted On 2022-10-06