Incidental Mutation 'R9617:Mybphl'
ID 726503
Institutional Source Beutler Lab
Gene Symbol Mybphl
Ensembl Gene ENSMUSG00000068745
Gene Name myosin binding protein H-like
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9617 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 108364911-108380057 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 108375636 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 247 (V247F)
Ref Sequence ENSEMBL: ENSMUSP00000088051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090563]
AlphaFold Q5FW53
Predicted Effect possibly damaging
Transcript: ENSMUST00000090563
AA Change: V247F

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088051
Gene: ENSMUSG00000068745
AA Change: V247F

DomainStartEndE-ValueType
IG 61 144 4.67e-4 SMART
FN3 147 229 1.62e-10 SMART
IG 268 352 3.68e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two immunoglobulin superfamily domains and a fibronectin 3 domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik C T 3: 68,870,069 P121L probably damaging Het
4930442H23Rik C T 10: 81,183,142 V16I unknown Het
4930444P10Rik T C 1: 16,068,827 M97V probably benign Het
Abcb1a A T 5: 8,747,353 probably null Het
Abhd5 T C 9: 122,367,970 I74T probably benign Het
Ankle2 T A 5: 110,251,543 F590I probably damaging Het
C2cd6 T C 1: 59,058,689 S414G probably benign Het
Catsperd G A 17: 56,661,252 D546N probably benign Het
Cep295nl G T 11: 118,333,174 H281Q possibly damaging Het
Cfap69 T C 5: 5,589,164 E670G probably damaging Het
Cfh A T 1: 140,162,980 V90E possibly damaging Het
Cnksr3 A C 10: 7,129,021 probably null Het
Cntrl T A 2: 35,145,065 F901L probably benign Het
Coch T A 12: 51,598,251 M196K probably damaging Het
Crygd T C 1: 65,063,210 N34S probably damaging Het
Ctdp1 A T 18: 80,449,747 I511N probably benign Het
Dhx30 C T 9: 110,097,118 A142T probably damaging Het
Dlg2 T C 7: 92,438,076 probably null Het
Dmxl1 A G 18: 49,865,161 D776G probably damaging Het
Dnm3 C T 1: 162,321,785 G197D probably damaging Het
Eif4g3 A G 4: 138,096,879 H91R probably damaging Het
Ephb6 A G 6: 41,619,324 M844V probably damaging Het
Erc1 T C 6: 119,796,941 E351G probably benign Het
Etfbkmt G A 6: 149,144,246 G33R probably benign Het
Fnbp4 T C 2: 90,758,394 I503T probably benign Het
Gm6370 A T 5: 146,493,183 Q143L probably benign Het
Gnas T C 2: 174,300,195 V719A possibly damaging Het
H13 C A 2: 152,688,953 D219E probably damaging Het
Hhatl G A 9: 121,789,125 T188I possibly damaging Het
Ifi27l2b C T 12: 103,456,424 A45T probably damaging Het
Kbtbd8 T C 6: 95,126,893 C585R possibly damaging Het
Limk2 A G 11: 3,347,715 S473P probably damaging Het
Lrba G A 3: 86,359,862 G1620S probably benign Het
Lrrtm2 T C 18: 35,213,437 T271A probably benign Het
Map3k4 A G 17: 12,257,984 S759P possibly damaging Het
Myh10 T A 11: 68,791,989 V1120D probably benign Het
Naip1 T C 13: 100,433,313 N271S probably benign Het
Napepld C T 5: 21,670,563 V328I probably damaging Het
Nucb1 A G 7: 45,498,735 V218A probably benign Het
Nup107 A T 10: 117,757,333 D813E probably benign Het
Olfr114 T A 17: 37,590,162 K64* probably null Het
Olfr781 A T 10: 129,332,925 T15S probably damaging Het
Olfr965 A G 9: 39,719,382 S52G possibly damaging Het
Olfr998 T A 2: 85,590,935 Y132N probably damaging Het
Pabpc2 T C 18: 39,774,549 I289T probably benign Het
Parg A G 14: 32,238,612 I600V probably benign Het
Patj T C 4: 98,505,754 F975L probably benign Het
Pcdhb17 A G 18: 37,485,165 T3A probably benign Het
Piezo2 T C 18: 63,115,037 E464G probably benign Het
Pkd1 T A 17: 24,581,367 V3034D probably damaging Het
Pld2 A G 11: 70,557,118 E869G probably damaging Het
Plek T A 11: 16,995,311 L29F possibly damaging Het
Prelp A G 1: 133,914,678 L243P probably damaging Het
Rapgef5 T A 12: 117,658,310 D231E probably benign Het
Riok1 A G 13: 38,060,040 E514G probably benign Het
Rmdn2 T C 17: 79,621,361 M14T probably benign Het
Rorb G A 19: 18,962,135 Q228* probably null Het
Scmh1 T A 4: 120,483,630 M171K probably damaging Het
Scn9a A G 2: 66,562,465 L261P probably damaging Het
Senp7 A T 16: 56,151,289 N263I probably benign Het
Slc11a1 G T 1: 74,379,882 A162S probably benign Het
Slc6a17 A G 3: 107,477,369 V305A probably damaging Het
Snph A T 2: 151,593,502 V502E probably damaging Het
Sost G T 11: 101,964,066 A139E possibly damaging Het
Srp54a A T 12: 55,089,276 E25D probably benign Het
Tmeff1 T A 4: 48,636,940 C213S probably damaging Het
Tmem232 A T 17: 65,500,185 Y4* probably null Het
Tmem63c T G 12: 87,056,587 I45S probably benign Het
Ttbk1 C T 17: 46,447,072 G879S probably damaging Het
Ugt1a7c A G 1: 88,095,230 H37R probably damaging Het
Vmn1r236 T C 17: 21,286,791 L57P probably damaging Het
Wnk2 T A 13: 49,038,977 E675V unknown Het
Wnt10b T C 15: 98,776,728 T43A probably damaging Het
Wnt8a C A 18: 34,547,110 T176K probably benign Het
Zfp937 T A 2: 150,238,532 C161S probably damaging Het
Other mutations in Mybphl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03365:Mybphl APN 3 108364998 start codon destroyed probably null 0.98
IGL03389:Mybphl APN 3 108375718 missense probably benign 0.09
R0194:Mybphl UTSW 3 108374168 missense probably benign 0.01
R0206:Mybphl UTSW 3 108375415 missense probably damaging 1.00
R0206:Mybphl UTSW 3 108375415 missense probably damaging 1.00
R0208:Mybphl UTSW 3 108375415 missense probably damaging 1.00
R1067:Mybphl UTSW 3 108365003 missense probably benign
R1223:Mybphl UTSW 3 108375196 missense possibly damaging 0.81
R1748:Mybphl UTSW 3 108375084 critical splice acceptor site probably null
R2013:Mybphl UTSW 3 108375402 missense probably benign 0.02
R2102:Mybphl UTSW 3 108375633 missense possibly damaging 0.82
R2121:Mybphl UTSW 3 108375176 missense probably damaging 1.00
R2197:Mybphl UTSW 3 108377319 missense probably damaging 1.00
R2265:Mybphl UTSW 3 108365001 missense probably damaging 1.00
R2266:Mybphl UTSW 3 108365001 missense probably damaging 1.00
R2267:Mybphl UTSW 3 108365001 missense probably damaging 1.00
R2268:Mybphl UTSW 3 108365001 missense probably damaging 1.00
R4551:Mybphl UTSW 3 108374163 missense possibly damaging 0.49
R4570:Mybphl UTSW 3 108365031 missense possibly damaging 0.61
R4693:Mybphl UTSW 3 108375178 missense probably benign 0.01
R5759:Mybphl UTSW 3 108374754 missense probably benign 0.30
R7017:Mybphl UTSW 3 108374838 missense probably damaging 0.99
R7526:Mybphl UTSW 3 108374180 missense probably benign 0.00
R8266:Mybphl UTSW 3 108377360 missense probably damaging 1.00
R8976:Mybphl UTSW 3 108365018 missense probably damaging 1.00
R9440:Mybphl UTSW 3 108374886 missense probably benign 0.19
R9655:Mybphl UTSW 3 108374783 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTTGCGGAGAACCAGTG -3'
(R):5'- ATGCCCTGTGATATAGCTCAG -3'

Sequencing Primer
(F):5'- AGAACCAGTGTGGGCTCAGC -3'
(R):5'- CCCTGTGATATAGCTCAGGTTAG -3'
Posted On 2022-10-06