Incidental Mutation 'R9619:Ubqln3'
ID 726591
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R9619 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103791053 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 346 (F346L)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably benign
Transcript: ENSMUST00000057254
AA Change: F346L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: F346L

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 14,101,566 (GRCm39) L1033P probably damaging Het
Agrn A G 4: 156,258,490 (GRCm39) I992T probably benign Het
Akap9 A T 5: 4,094,833 (GRCm39) E2209V probably damaging Het
Arfip1 C T 3: 84,435,081 (GRCm39) G76E probably benign Het
Arsk T C 13: 76,223,151 (GRCm39) T149A probably damaging Het
Caap1 A G 4: 94,444,718 (GRCm39) V75A possibly damaging Het
Cenpf A G 1: 189,385,965 (GRCm39) V2105A probably benign Het
Cep152 A G 2: 125,436,827 (GRCm39) F571S probably benign Het
Crx A T 7: 15,602,185 (GRCm39) D164E probably benign Het
Csgalnact1 A G 8: 68,854,006 (GRCm39) V265A probably damaging Het
Dchs1 C T 7: 105,413,662 (GRCm39) R1051Q probably benign Het
Dld A T 12: 31,382,390 (GRCm39) L471* probably null Het
Dmrtb1 G T 4: 107,540,847 (GRCm39) H171Q probably benign Het
Dnajc12 G A 10: 63,233,075 (GRCm39) R72Q probably damaging Het
Dpf1 A G 7: 29,012,618 (GRCm39) H237R probably benign Het
Dsg1c T A 18: 20,416,499 (GRCm39) L800Q probably damaging Het
Dyrk2 A T 10: 118,696,292 (GRCm39) L322Q probably damaging Het
Ect2 A G 3: 27,201,026 (GRCm39) V149A probably benign Het
Efhc1 G A 1: 21,037,603 (GRCm39) R260H probably benign Het
Emp2 G T 16: 10,102,420 (GRCm39) Q131K probably benign Het
Ephb6 T C 6: 41,594,249 (GRCm39) I593T possibly damaging Het
Fbln5 A C 12: 101,723,552 (GRCm39) I383S probably damaging Het
Foxq1 A T 13: 31,743,580 (GRCm39) E227D probably benign Het
Gm8237 A T 14: 5,863,637 (GRCm38) N9K probably damaging Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Ifi44 T C 3: 151,451,509 (GRCm39) N199S probably damaging Het
Ifna16 T G 4: 88,594,762 (GRCm39) D111A probably benign Het
Igdcc3 A G 9: 65,092,552 (GRCm39) D793G probably benign Het
Igfbp5 A G 1: 72,901,543 (GRCm39) V270A probably benign Het
Kif20b A C 19: 34,933,429 (GRCm39) D1345A probably damaging Het
Klhl9 T C 4: 88,639,062 (GRCm39) H393R probably benign Het
Lad1 G T 1: 135,755,521 (GRCm39) A266S possibly damaging Het
Lama2 A G 10: 27,064,282 (GRCm39) L1233P probably damaging Het
Limch1 T C 5: 67,015,284 (GRCm39) I52T probably damaging Het
Loxhd1 T C 18: 77,443,871 (GRCm39) F599L probably benign Het
Mfn1 A G 3: 32,628,478 (GRCm39) D703G possibly damaging Het
Nexmif C T X: 103,129,841 (GRCm39) R692H possibly damaging Het
Ogfod2 G A 5: 124,252,470 (GRCm39) G183D probably damaging Het
Or2z8 T C 8: 72,811,605 (GRCm39) L27S probably damaging Het
Or5aq1b T A 2: 86,902,140 (GRCm39) I113F possibly damaging Het
Pcgf6 T C 19: 47,037,261 (GRCm39) T182A possibly damaging Het
Pcnx4 T A 12: 72,622,282 (GRCm39) C1084S possibly damaging Het
Peg10 A G 6: 4,755,316 (GRCm39) N366D probably benign Het
Prr16 T A 18: 51,435,797 (GRCm39) I92K possibly damaging Het
Rbm39 A T 2: 156,001,117 (GRCm39) N312K probably damaging Het
Rps10 G A 17: 27,849,459 (GRCm39) R160C probably benign Het
Scrg1 G T 8: 57,927,363 (GRCm39) V5L unknown Het
Slc39a4 T A 15: 76,497,874 (GRCm39) H408L probably damaging Het
Slco1a5 T C 6: 142,198,846 (GRCm39) E273G probably benign Het
Syne1 A C 10: 5,090,909 (GRCm39) V815G probably benign Het
Tekt2 C T 4: 126,217,444 (GRCm39) R207H probably damaging Het
Treml1 T A 17: 48,672,006 (GRCm39) F167I probably benign Het
Trpv2 T C 11: 62,480,562 (GRCm39) V333A probably damaging Het
Vmn2r15 T A 5: 109,440,622 (GRCm39) Y412F possibly damaging Het
Vmn2r61 A G 7: 41,926,136 (GRCm39) N547S probably damaging Het
Vopp1 G A 6: 57,731,617 (GRCm39) P125S probably benign Het
Wwc1 A G 11: 35,766,779 (GRCm39) F492S probably damaging Het
Zfp114 A G 7: 23,880,077 (GRCm39) E142G probably benign Het
Zfp715 A C 7: 42,949,104 (GRCm39) Y285* probably null Het
Zwilch A G 9: 64,057,440 (GRCm39) V442A probably benign Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGGGCATGATGACTTTCCC -3'
(R):5'- GCTACTACTGCTAGTACCACC -3'

Sequencing Primer
(F):5'- GGCATGATGACTTTCCCTTGATTGC -3'
(R):5'- TACTACTGCTAGTACCACCACCAC -3'
Posted On 2022-10-06