Mutagenetix > Incidental Mutation

Incidental Mutation 'R9619:Ubqln3'

726591

Institutional Source

Beutler Lab

Gene Symbol

Ubqln3

Ensembl Gene

ENSMUSG00000051618

Gene Name

ubiquilin 3

Synonyms

4933400K24Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R9619 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

104140623-104143279 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104141846 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 346 (F346L)

Ref Sequence

ENSEMBL: ENSMUSP00000055229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]

AlphaFold

Q8C5U9

Predicted Effect

probably benign
Transcript: ENSMUST00000057254
AA Change: F346L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: F346L

Domain	Start	End	E-Value	Type
UBQ	22	92	1.56e-15	SMART
low complexity region	103	115	N/A	INTRINSIC
low complexity region	120	151	N/A	INTRINSIC
STI1	194	233	4.25e-7	SMART
low complexity region	280	291	N/A	INTRINSIC
low complexity region	313	328	N/A	INTRINSIC
low complexity region	505	515	N/A	INTRINSIC
UBA	619	657	4.22e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138055

SMART Domains

Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afdn	T	C	17: 13,881,304	L1033P	probably damaging	Het
Agrn	A	G	4: 156,174,033	I992T	probably benign	Het
Akap9	A	T	5: 4,044,833	E2209V	probably damaging	Het
Arfip1	C	T	3: 84,527,774	G76E	probably benign	Het
Arsk	T	C	13: 76,075,032	T149A	probably damaging	Het
Caap1	A	G	4: 94,556,481	V75A	possibly damaging	Het
Cenpf	A	G	1: 189,653,768	V2105A	probably benign	Het
Cep152	A	G	2: 125,594,907	F571S	probably benign	Het
Crx	A	T	7: 15,868,260	D164E	probably benign	Het
Csgalnact1	A	G	8: 68,401,354	V265A	probably damaging	Het
Dchs1	C	T	7: 105,764,455	R1051Q	probably benign	Het
Dld	A	T	12: 31,332,391	L471*	probably null	Het
Dmrtb1	G	T	4: 107,683,650	H171Q	probably benign	Het
Dnajc12	G	A	10: 63,397,296	R72Q	probably damaging	Het
Dpf1	A	G	7: 29,313,193	H237R	probably benign	Het
Dsg1c	T	A	18: 20,283,442	L800Q	probably damaging	Het
Dyrk2	A	T	10: 118,860,387	L322Q	probably damaging	Het
Ect2	A	G	3: 27,146,877	V149A	probably benign	Het
Efhc1	G	A	1: 20,967,379	R260H	probably benign	Het
Emp2	G	T	16: 10,284,556	Q131K	probably benign	Het
Ephb6	T	C	6: 41,617,315	I593T	possibly damaging	Het
Fbln5	A	C	12: 101,757,293	I383S	probably damaging	Het
Foxq1	A	T	13: 31,559,597	E227D	probably benign	Het
Gm8237	A	T	14: 5,863,637	N9K	probably damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ifi44	T	C	3: 151,745,872	N199S	probably damaging	Het
Ifna16	T	G	4: 88,676,525	D111A	probably benign	Het
Igdcc3	A	G	9: 65,185,270	D793G	probably benign	Het
Igfbp5	A	G	1: 72,862,384	V270A	probably benign	Het
Kif20b	A	C	19: 34,956,029	D1345A	probably damaging	Het
Klhl9	T	C	4: 88,720,825	H393R	probably benign	Het
Lad1	G	T	1: 135,827,783	A266S	possibly damaging	Het
Lama2	A	G	10: 27,188,286	L1233P	probably damaging	Het
Limch1	T	C	5: 66,857,941	I52T	probably damaging	Het
Loxhd1	T	C	18: 77,356,175	F599L	probably benign	Het
Mfn1	A	G	3: 32,574,329	D703G	possibly damaging	Het
Nexmif	C	T	X: 104,086,235	R692H	possibly damaging	Het
Ogfod2	G	A	5: 124,114,407	G183D	probably damaging	Het
Olfr1107	T	A	2: 87,071,796	I113F	possibly damaging	Het
Olfr372	T	C	8: 72,057,761	L27S	probably damaging	Het
Pcgf6	T	C	19: 47,048,822	T182A	possibly damaging	Het
Pcnx4	T	A	12: 72,575,508	C1084S	possibly damaging	Het
Peg10	A	G	6: 4,755,316	N366D	probably benign	Het
Prr16	T	A	18: 51,302,725	I92K	possibly damaging	Het
Rbm39	A	T	2: 156,159,197	N312K	probably damaging	Het
Rps10	G	A	17: 27,630,485	R160C	probably benign	Het
Scrg1	G	T	8: 57,474,329	V5L	unknown	Het
Slc39a4	T	A	15: 76,613,674	H408L	probably damaging	Het
Slco1a5	T	C	6: 142,253,120	E273G	probably benign	Het
Syne1	A	C	10: 5,140,909	V815G	probably benign	Het
Tekt2	C	T	4: 126,323,651	R207H	probably damaging	Het
Treml1	T	A	17: 48,364,978	F167I	probably benign	Het
Trpv2	T	C	11: 62,589,736	V333A	probably damaging	Het
Vmn2r15	T	A	5: 109,292,756	Y412F	possibly damaging	Het
Vmn2r61	A	G	7: 42,276,712	N547S	probably damaging	Het
Vopp1	G	A	6: 57,754,632	P125S	probably benign	Het
Wwc1	A	G	11: 35,875,952	F492S	probably damaging	Het
Zfp114	A	G	7: 24,180,652	E142G	probably benign	Het
Zfp715	A	C	7: 43,299,680	Y285*	probably null	Het
Zwilch	A	G	9: 64,150,158	V442A	probably benign	Het

Other mutations in Ubqln3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Ubqln3	APN	7	104141777	missense	probably benign	0.00
IGL00766:Ubqln3	APN	7	104142824	missense	probably benign	0.00
IGL01451:Ubqln3	APN	7	104142196	missense	possibly damaging	0.71
IGL01673:Ubqln3	APN	7	104142398	missense	probably benign	0.12
IGL01705:Ubqln3	APN	7	104142677	missense	probably damaging	1.00
IGL01988:Ubqln3	APN	7	104142882	utr 5 prime	probably benign
IGL02008:Ubqln3	APN	7	104142316	missense	probably damaging	1.00
IGL02072:Ubqln3	APN	7	104141299	missense	possibly damaging	0.69
IGL02546:Ubqln3	APN	7	104142518	missense	probably benign	0.02
IGL02657:Ubqln3	APN	7	104141963	missense	probably damaging	0.97
IGL02682:Ubqln3	APN	7	104142065	missense	probably benign	0.19
IGL02709:Ubqln3	APN	7	104141336	missense	probably benign	0.12
IGL03357:Ubqln3	APN	7	104142556	missense	probably benign
PIT4544001:Ubqln3	UTSW	7	104141343	missense	probably damaging	0.97
R0180:Ubqln3	UTSW	7	104141840	missense	probably damaging	1.00
R0845:Ubqln3	UTSW	7	104142068	missense	probably damaging	0.98
R1019:Ubqln3	UTSW	7	104141386	missense	probably benign	0.00
R1280:Ubqln3	UTSW	7	104142076	missense	possibly damaging	0.85
R1448:Ubqln3	UTSW	7	104142790	missense	probably damaging	1.00
R1550:Ubqln3	UTSW	7	104141546	missense	probably damaging	0.98
R1617:Ubqln3	UTSW	7	104142860	missense	possibly damaging	0.95
R1650:Ubqln3	UTSW	7	104141021	missense	possibly damaging	0.84
R2060:Ubqln3	UTSW	7	104142151	missense	probably damaging	1.00
R2246:Ubqln3	UTSW	7	104142311	missense	probably damaging	1.00
R2263:Ubqln3	UTSW	7	104141635	nonsense	probably null
R2366:Ubqln3	UTSW	7	104141049	missense	probably damaging	0.99
R4232:Ubqln3	UTSW	7	104141803	missense	probably benign	0.00
R4447:Ubqln3	UTSW	7	104142814	missense	probably benign	0.31
R4509:Ubqln3	UTSW	7	104141444	missense	probably damaging	0.97
R4604:Ubqln3	UTSW	7	104142491	missense	probably benign	0.00
R5416:Ubqln3	UTSW	7	104141672	missense	probably benign	0.34
R5617:Ubqln3	UTSW	7	104142433	missense	probably damaging	0.99
R5648:Ubqln3	UTSW	7	104140910	missense	probably damaging	0.99
R5722:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5723:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5724:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5819:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5820:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5966:Ubqln3	UTSW	7	104141699	missense	probably benign	0.03
R6260:Ubqln3	UTSW	7	104142317	nonsense	probably null
R6272:Ubqln3	UTSW	7	104142178	missense	probably damaging	1.00
R6542:Ubqln3	UTSW	7	104141617	missense	probably benign	0.00
R6936:Ubqln3	UTSW	7	104142310	missense	probably damaging	1.00
R7023:Ubqln3	UTSW	7	104141423	missense	probably damaging	1.00
R7025:Ubqln3	UTSW	7	104141275	missense	probably benign	0.01
R7079:Ubqln3	UTSW	7	104141371	missense	probably benign	0.12
R7733:Ubqln3	UTSW	7	104141076	missense	probably damaging	0.98
R7764:Ubqln3	UTSW	7	104141236	missense	possibly damaging	0.52
R7919:Ubqln3	UTSW	7	104141192	missense	probably benign	0.03
R7961:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
R8009:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
R9652:Ubqln3	UTSW	7	104142755	missense	probably damaging	1.00
RF054:Ubqln3	UTSW	7	104141178	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CTGGGCATGATGACTTTCCC -3'
(R):5'- GCTACTACTGCTAGTACCACC -3'

Sequencing Primer
(F):5'- GGCATGATGACTTTCCCTTGATTGC -3'
(R):5'- TACTACTGCTAGTACCACCACCAC -3'

Posted On

2022-10-06