Incidental Mutation 'R9619:Ubqln3'
ID 726591
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock # R9619 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 104140623-104143279 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104141846 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 346 (F346L)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably benign
Transcript: ENSMUST00000057254
AA Change: F346L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: F346L

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,881,304 L1033P probably damaging Het
Agrn A G 4: 156,174,033 I992T probably benign Het
Akap9 A T 5: 4,044,833 E2209V probably damaging Het
Arfip1 C T 3: 84,527,774 G76E probably benign Het
Arsk T C 13: 76,075,032 T149A probably damaging Het
Caap1 A G 4: 94,556,481 V75A possibly damaging Het
Cenpf A G 1: 189,653,768 V2105A probably benign Het
Cep152 A G 2: 125,594,907 F571S probably benign Het
Crx A T 7: 15,868,260 D164E probably benign Het
Csgalnact1 A G 8: 68,401,354 V265A probably damaging Het
Dchs1 C T 7: 105,764,455 R1051Q probably benign Het
Dld A T 12: 31,332,391 L471* probably null Het
Dmrtb1 G T 4: 107,683,650 H171Q probably benign Het
Dnajc12 G A 10: 63,397,296 R72Q probably damaging Het
Dpf1 A G 7: 29,313,193 H237R probably benign Het
Dsg1c T A 18: 20,283,442 L800Q probably damaging Het
Dyrk2 A T 10: 118,860,387 L322Q probably damaging Het
Ect2 A G 3: 27,146,877 V149A probably benign Het
Efhc1 G A 1: 20,967,379 R260H probably benign Het
Emp2 G T 16: 10,284,556 Q131K probably benign Het
Ephb6 T C 6: 41,617,315 I593T possibly damaging Het
Fbln5 A C 12: 101,757,293 I383S probably damaging Het
Foxq1 A T 13: 31,559,597 E227D probably benign Het
Gm8237 A T 14: 5,863,637 N9K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifi44 T C 3: 151,745,872 N199S probably damaging Het
Ifna16 T G 4: 88,676,525 D111A probably benign Het
Igdcc3 A G 9: 65,185,270 D793G probably benign Het
Igfbp5 A G 1: 72,862,384 V270A probably benign Het
Kif20b A C 19: 34,956,029 D1345A probably damaging Het
Klhl9 T C 4: 88,720,825 H393R probably benign Het
Lad1 G T 1: 135,827,783 A266S possibly damaging Het
Lama2 A G 10: 27,188,286 L1233P probably damaging Het
Limch1 T C 5: 66,857,941 I52T probably damaging Het
Loxhd1 T C 18: 77,356,175 F599L probably benign Het
Mfn1 A G 3: 32,574,329 D703G possibly damaging Het
Nexmif C T X: 104,086,235 R692H possibly damaging Het
Ogfod2 G A 5: 124,114,407 G183D probably damaging Het
Olfr1107 T A 2: 87,071,796 I113F possibly damaging Het
Olfr372 T C 8: 72,057,761 L27S probably damaging Het
Pcgf6 T C 19: 47,048,822 T182A possibly damaging Het
Pcnx4 T A 12: 72,575,508 C1084S possibly damaging Het
Peg10 A G 6: 4,755,316 N366D probably benign Het
Prr16 T A 18: 51,302,725 I92K possibly damaging Het
Rbm39 A T 2: 156,159,197 N312K probably damaging Het
Rps10 G A 17: 27,630,485 R160C probably benign Het
Scrg1 G T 8: 57,474,329 V5L unknown Het
Slc39a4 T A 15: 76,613,674 H408L probably damaging Het
Slco1a5 T C 6: 142,253,120 E273G probably benign Het
Syne1 A C 10: 5,140,909 V815G probably benign Het
Tekt2 C T 4: 126,323,651 R207H probably damaging Het
Treml1 T A 17: 48,364,978 F167I probably benign Het
Trpv2 T C 11: 62,589,736 V333A probably damaging Het
Vmn2r15 T A 5: 109,292,756 Y412F possibly damaging Het
Vmn2r61 A G 7: 42,276,712 N547S probably damaging Het
Vopp1 G A 6: 57,754,632 P125S probably benign Het
Wwc1 A G 11: 35,875,952 F492S probably damaging Het
Zfp114 A G 7: 24,180,652 E142G probably benign Het
Zfp715 A C 7: 43,299,680 Y285* probably null Het
Zwilch A G 9: 64,150,158 V442A probably benign Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 104141777 missense probably benign 0.00
IGL00766:Ubqln3 APN 7 104142824 missense probably benign 0.00
IGL01451:Ubqln3 APN 7 104142196 missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 104142398 missense probably benign 0.12
IGL01705:Ubqln3 APN 7 104142677 missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 104142882 utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 104142316 missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 104141299 missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 104142518 missense probably benign 0.02
IGL02657:Ubqln3 APN 7 104141963 missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 104142065 missense probably benign 0.19
IGL02709:Ubqln3 APN 7 104141336 missense probably benign 0.12
IGL03357:Ubqln3 APN 7 104142556 missense probably benign
PIT4544001:Ubqln3 UTSW 7 104141343 missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 104141840 missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 104142068 missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 104141386 missense probably benign 0.00
R1280:Ubqln3 UTSW 7 104142076 missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 104142790 missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 104141546 missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 104142860 missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 104141021 missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 104142151 missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 104142311 missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 104141635 nonsense probably null
R2366:Ubqln3 UTSW 7 104141049 missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 104141803 missense probably benign 0.00
R4447:Ubqln3 UTSW 7 104142814 missense probably benign 0.31
R4509:Ubqln3 UTSW 7 104141444 missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 104142491 missense probably benign 0.00
R5416:Ubqln3 UTSW 7 104141672 missense probably benign 0.34
R5617:Ubqln3 UTSW 7 104142433 missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 104140910 missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5723:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5724:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5819:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5820:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5966:Ubqln3 UTSW 7 104141699 missense probably benign 0.03
R6260:Ubqln3 UTSW 7 104142317 nonsense probably null
R6272:Ubqln3 UTSW 7 104142178 missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 104141617 missense probably benign 0.00
R6936:Ubqln3 UTSW 7 104142310 missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 104141423 missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 104141275 missense probably benign 0.01
R7079:Ubqln3 UTSW 7 104141371 missense probably benign 0.12
R7733:Ubqln3 UTSW 7 104141076 missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 104141236 missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 104141192 missense probably benign 0.03
R7961:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
R8009:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
R9652:Ubqln3 UTSW 7 104142755 missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 104141178 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGGGCATGATGACTTTCCC -3'
(R):5'- GCTACTACTGCTAGTACCACC -3'

Sequencing Primer
(F):5'- GGCATGATGACTTTCCCTTGATTGC -3'
(R):5'- TACTACTGCTAGTACCACCACCAC -3'
Posted On 2022-10-06