Incidental Mutation 'R9637:Pigt'
ID 726621
Institutional Source Beutler Lab
Gene Symbol Pigt
Ensembl Gene ENSMUSG00000017721
Gene Name phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms Ndap7, CGI-06, 4930534E15Rik, NDAP, 2510012P17Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.763) question?
Stock # R9637 (G1)
Quality Score 214.458
Status Not validated
Chromosome 2
Chromosomal Location 164339461-164350221 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT at 164341589 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103101] [ENSMUST00000117066]
AlphaFold Q8BXQ2
Predicted Effect probably null
Transcript: ENSMUST00000103101
SMART Domains Protein: ENSMUSP00000099390
Gene: ENSMUSG00000017721

DomainStartEndE-ValueType
Pfam:Gpi16 22 576 4.9e-155 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117066
SMART Domains Protein: ENSMUSP00000112577
Gene: ENSMUSG00000017721

DomainStartEndE-ValueType
Pfam:Gpi16 11 419 4.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152522
SMART Domains Protein: ENSMUSP00000115362
Gene: ENSMUSG00000017721

DomainStartEndE-ValueType
Pfam:Gpi16 21 134 2.7e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a null mutation do not survive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 1 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Pear1 C T 3: 87,666,412 (GRCm39) G97E probably benign Het
Other mutations in Pigt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03076:Pigt APN 2 164,339,585 (GRCm39) missense probably damaging 1.00
BB003:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R1548:Pigt UTSW 2 164,343,439 (GRCm39) missense probably benign 0.37
R1551:Pigt UTSW 2 164,349,323 (GRCm39) missense probably damaging 0.99
R1605:Pigt UTSW 2 164,349,419 (GRCm39) missense probably damaging 1.00
R3712:Pigt UTSW 2 164,343,565 (GRCm39) missense probably benign 0.00
R3848:Pigt UTSW 2 164,340,500 (GRCm39) critical splice donor site probably benign
R4672:Pigt UTSW 2 164,339,498 (GRCm39) unclassified probably benign
R4719:Pigt UTSW 2 164,343,544 (GRCm39) missense probably damaging 0.98
R5481:Pigt UTSW 2 164,348,342 (GRCm39) missense probably damaging 1.00
R5567:Pigt UTSW 2 164,343,482 (GRCm39) nonsense probably null
R5570:Pigt UTSW 2 164,343,482 (GRCm39) nonsense probably null
R5998:Pigt UTSW 2 164,349,374 (GRCm39) missense possibly damaging 0.82
R6112:Pigt UTSW 2 164,348,365 (GRCm39) nonsense probably null
R6816:Pigt UTSW 2 164,343,052 (GRCm39) missense probably damaging 1.00
R6889:Pigt UTSW 2 164,349,251 (GRCm39) missense probably damaging 1.00
R7019:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R7037:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R7197:Pigt UTSW 2 164,344,436 (GRCm39) missense probably damaging 1.00
R7288:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R7449:Pigt UTSW 2 164,344,419 (GRCm39) missense probably damaging 1.00
R7822:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R7926:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R8005:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R8019:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R8330:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R8675:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R8893:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R8968:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R9155:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R9334:Pigt UTSW 2 164,349,420 (GRCm39) makesense probably null
R9386:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R9418:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R9426:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R9558:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
R9676:Pigt UTSW 2 164,341,589 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCCCAGGCAAGATGGACAC -3'
(R):5'- AGGGATGCACAGAAGATCCC -3'

Sequencing Primer
(F):5'- CTTGAACAAAGACCTGCAGGGC -3'
(R):5'- TGCACAGAAGATCCCCGAGAG -3'
Posted On 2022-10-06