Incidental Mutation 'R9646:Fat4'
ID 726707
Institutional Source Beutler Lab
Gene Symbol Fat4
Ensembl Gene ENSMUSG00000046743
Gene Name FAT atypical cadherin 4
Synonyms 6030410K14Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9646 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 38941089-39066134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39035813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 3155 (D3155G)
Ref Sequence ENSEMBL: ENSMUSP00000061836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061260]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000061260
AA Change: D3155G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061836
Gene: ENSMUSG00000046743
AA Change: D3155G

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
CA 60 133 4.09e-7 SMART
CA 157 248 4.51e-18 SMART
CA 272 351 7.66e-30 SMART
CA 380 473 2.55e-17 SMART
CA 497 580 8.27e-26 SMART
CA 605 687 6.46e-28 SMART
CA 711 791 1e-24 SMART
CA 815 891 3.78e-20 SMART
CA 915 994 8.6e-24 SMART
CA 1018 1098 7.09e-25 SMART
CA 1122 1208 6.78e-22 SMART
CA 1232 1313 2.63e-28 SMART
CA 1337 1418 7.25e-31 SMART
CA 1442 1527 4.58e-19 SMART
CA 1550 1629 4.52e-9 SMART
CA 1651 1738 1.3e-9 SMART
CA 1762 1839 2.01e-24 SMART
CA 1863 1942 3.11e-21 SMART
CA 1966 2049 5.85e-26 SMART
CA 2072 2152 1.88e-29 SMART
CA 2176 2257 3.06e-29 SMART
CA 2282 2362 2.61e-23 SMART
CA 2386 2466 2.99e-32 SMART
CA 2490 2568 9.92e-6 SMART
CA 2588 2669 6.58e-20 SMART
CA 2692 2773 7.25e-31 SMART
CA 2796 2872 1.69e-22 SMART
CA 2896 2983 3.16e-22 SMART
CA 3007 3089 1.01e-15 SMART
CA 3113 3194 1.25e-25 SMART
CA 3218 3298 7e-15 SMART
CA 3322 3405 3.96e-14 SMART
CA 3428 3510 3.41e-27 SMART
CA 3532 3614 5.64e-19 SMART
EGF 3807 3862 1.78e-2 SMART
EGF_CA 3864 3900 2.36e-16 SMART
EGF_CA 3902 3938 7.99e-14 SMART
EGF 3943 3976 1.24e-1 SMART
LamG 3996 4144 4.08e-19 SMART
EGF 4167 4200 5.88e-3 SMART
LamG 4244 4375 1.76e-23 SMART
EGF 4430 4464 1.41e-5 SMART
low complexity region 4514 4526 N/A INTRINSIC
low complexity region 4533 4550 N/A INTRINSIC
low complexity region 4840 4849 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protocadherin family. This gene may play a role in regulating planar cell polarity (PCP). Studies in mice suggest that loss of PCP signaling may cause cystic kidney disease, and mutations in this gene have been associated with Van Maldergem Syndrome 2. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, reduced birth body size, curly tails, kyphosis, small lungs, renal cysts, and defects in sternum and vertebrae morphology, neural tube width, cochlear elongation, stereocilia orientation, kidney development, and intestinal elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl2 A T 3: 148,544,926 (GRCm39) I723N probably damaging Het
Agbl1 G A 7: 76,075,648 (GRCm39) R682Q unknown Het
Ankrd42 A T 7: 92,273,257 (GRCm39) D123E possibly damaging Het
Anxa4 A T 6: 86,730,814 (GRCm39) I121N probably damaging Het
Asic1 T C 15: 99,593,414 (GRCm39) F257S probably benign Het
Catsper2 TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT 2: 121,228,053 (GRCm39) probably benign Het
Cckar T C 5: 53,863,608 (GRCm39) T118A probably benign Het
Cfap61 T A 2: 145,854,152 (GRCm39) I388N probably damaging Het
Chrnd A T 1: 87,120,311 (GRCm39) I156F probably damaging Het
Col15a1 T A 4: 47,257,187 (GRCm39) L326Q possibly damaging Het
Dcpp3 A T 17: 24,138,156 (GRCm39) I105L possibly damaging Het
Dnaaf5 T A 5: 139,151,832 (GRCm39) H494Q probably benign Het
Dph5 T A 3: 115,708,692 (GRCm39) Y125N probably damaging Het
Eif4enif1 T C 11: 3,170,280 (GRCm39) V111A probably damaging Het
Etl4 T A 2: 20,802,724 (GRCm39) I1010K probably benign Het
Faf1 T A 4: 109,652,016 (GRCm39) W236R probably damaging Het
Fhip2b T C 14: 70,827,808 (GRCm39) H125R probably damaging Het
Firrm A G 1: 163,822,195 (GRCm39) V32A probably damaging Het
Galnt12 T C 4: 47,120,390 (GRCm39) I491T probably damaging Het
Gm10553 T A 1: 85,077,901 (GRCm39) L6Q probably damaging Het
H2-T10 A T 17: 36,431,157 (GRCm39) I168N probably damaging Het
Hdac9 T A 12: 34,487,167 (GRCm39) Q78L probably damaging Het
Hmx1 C T 5: 35,549,400 (GRCm39) T231M probably damaging Het
Hrob A T 11: 102,146,586 (GRCm39) Q287H possibly damaging Het
Hsd17b13 T C 5: 104,124,973 (GRCm39) K70R probably null Het
Hykk C T 9: 54,853,521 (GRCm39) T281I probably benign Het
Il1r2 A G 1: 40,162,362 (GRCm39) D335G probably damaging Het
Insig2 A C 1: 121,240,040 (GRCm39) L87V probably damaging Het
Insrr A T 3: 87,721,805 (GRCm39) Y1193F probably damaging Het
Itpr1 A G 6: 108,371,845 (GRCm39) Y1173C probably damaging Het
Kcnh8 A G 17: 53,104,573 (GRCm39) N190S probably benign Het
Kntc1 T C 5: 123,897,119 (GRCm39) F161L probably benign Het
Lilra5 T C 7: 4,244,907 (GRCm39) L226P probably damaging Het
Muc2 C T 7: 141,276,643 (GRCm39) A11V probably benign Het
Nrp2 T C 1: 62,777,566 (GRCm39) F124L probably damaging Het
Or52e4 T C 7: 104,706,374 (GRCm39) I307T probably benign Het
Or5m11b T A 2: 85,806,446 (GRCm39) N286K probably benign Het
Or5w15 T A 2: 87,568,512 (GRCm39) D52V probably damaging Het
Or8c19-ps1 T A 9: 38,220,114 (GRCm39) S8T probably damaging Het
Pcdhb17 A T 18: 37,618,471 (GRCm39) N87I possibly damaging Het
Pdgfrb T A 18: 61,211,721 (GRCm39) probably null Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Pepd A T 7: 34,620,882 (GRCm39) Q49L possibly damaging Het
Pigo C A 4: 43,017,967 (GRCm39) R1083L probably damaging Het
Pitpnm1 G A 19: 4,153,269 (GRCm39) D142N probably damaging Het
Plod1 C T 4: 148,016,112 (GRCm39) E93K probably benign Het
Pramel11 A T 4: 143,623,634 (GRCm39) V180E probably damaging Het
Rev3l T C 10: 39,698,440 (GRCm39) I979T probably damaging Het
Scrib C T 15: 75,932,492 (GRCm39) G743D probably damaging Het
Septin3 T C 15: 82,170,088 (GRCm39) S205P probably benign Het
Sez6 A G 11: 77,867,632 (GRCm39) K850E probably damaging Het
Sfxn5 T A 6: 85,266,195 (GRCm39) T101S probably damaging Het
Slc6a5 A T 7: 49,567,496 (GRCm39) K317* probably null Het
Sox8 A T 17: 25,786,871 (GRCm39) D277E probably benign Het
Sptbn2 G T 19: 4,795,341 (GRCm39) A1600S probably damaging Het
Syne1 A G 10: 5,179,187 (GRCm39) V4429A possibly damaging Het
Tnrc6b T A 15: 80,773,266 (GRCm39) F1137L possibly damaging Het
Trim43a A G 9: 88,466,392 (GRCm39) R238G probably benign Het
Triobp T C 15: 78,887,934 (GRCm39) L1943P probably damaging Het
Vmn1r125 T C 7: 21,006,261 (GRCm39) V53A possibly damaging Het
Vwa5b1 T A 4: 138,319,420 (GRCm39) N412I probably damaging Het
Yipf7 T A 5: 69,678,424 (GRCm39) T122S probably benign Het
Zfp1005 C T 2: 150,110,104 (GRCm39) H265Y probably benign Het
Other mutations in Fat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fat4 APN 3 39,036,398 (GRCm39) missense probably damaging 1.00
IGL00509:Fat4 APN 3 38,943,188 (GRCm39) missense probably damaging 1.00
IGL00698:Fat4 APN 3 39,035,294 (GRCm39) missense probably benign 0.17
IGL00934:Fat4 APN 3 38,944,822 (GRCm39) missense probably damaging 1.00
IGL01063:Fat4 APN 3 38,944,728 (GRCm39) missense possibly damaging 0.80
IGL01123:Fat4 APN 3 39,011,418 (GRCm39) missense probably benign 0.00
IGL01313:Fat4 APN 3 39,061,350 (GRCm39) missense possibly damaging 0.53
IGL01328:Fat4 APN 3 39,034,807 (GRCm39) missense probably damaging 1.00
IGL01328:Fat4 APN 3 38,944,140 (GRCm39) missense probably damaging 1.00
IGL01374:Fat4 APN 3 38,941,647 (GRCm39) missense probably damaging 1.00
IGL01412:Fat4 APN 3 38,945,330 (GRCm39) missense probably benign 0.09
IGL01472:Fat4 APN 3 38,942,219 (GRCm39) missense probably damaging 1.00
IGL01514:Fat4 APN 3 39,003,683 (GRCm39) missense possibly damaging 0.89
IGL01548:Fat4 APN 3 39,063,406 (GRCm39) missense probably damaging 1.00
IGL01548:Fat4 APN 3 38,941,907 (GRCm39) missense probably damaging 0.99
IGL01576:Fat4 APN 3 38,943,096 (GRCm39) missense probably damaging 1.00
IGL01591:Fat4 APN 3 39,064,524 (GRCm39) nonsense probably null
IGL01626:Fat4 APN 3 39,005,181 (GRCm39) missense probably damaging 1.00
IGL01746:Fat4 APN 3 39,045,880 (GRCm39) nonsense probably null
IGL01800:Fat4 APN 3 39,035,878 (GRCm39) missense probably damaging 0.99
IGL01815:Fat4 APN 3 38,942,922 (GRCm39) missense probably damaging 1.00
IGL01863:Fat4 APN 3 39,024,768 (GRCm39) splice site probably benign
IGL01917:Fat4 APN 3 38,943,879 (GRCm39) missense possibly damaging 0.89
IGL01936:Fat4 APN 3 39,033,923 (GRCm39) missense probably benign 0.10
IGL02060:Fat4 APN 3 39,064,420 (GRCm39) missense probably damaging 1.00
IGL02103:Fat4 APN 3 38,943,348 (GRCm39) missense probably damaging 0.97
IGL02119:Fat4 APN 3 39,037,088 (GRCm39) missense probably benign 0.10
IGL02124:Fat4 APN 3 38,942,553 (GRCm39) missense probably damaging 1.00
IGL02164:Fat4 APN 3 39,050,354 (GRCm39) critical splice donor site probably null
IGL02182:Fat4 APN 3 38,944,695 (GRCm39) missense probably damaging 1.00
IGL02207:Fat4 APN 3 39,005,412 (GRCm39) missense probably benign 0.16
IGL02210:Fat4 APN 3 38,946,002 (GRCm39) missense probably benign 0.01
IGL02257:Fat4 APN 3 39,055,288 (GRCm39) missense probably benign 0.09
IGL02271:Fat4 APN 3 39,034,068 (GRCm39) missense probably benign 0.18
IGL02305:Fat4 APN 3 39,064,137 (GRCm39) missense probably damaging 1.00
IGL02314:Fat4 APN 3 38,941,779 (GRCm39) missense probably damaging 1.00
IGL02455:Fat4 APN 3 39,005,280 (GRCm39) missense possibly damaging 0.48
IGL02468:Fat4 APN 3 39,037,195 (GRCm39) missense probably benign
IGL02478:Fat4 APN 3 38,942,364 (GRCm39) missense probably damaging 1.00
IGL02480:Fat4 APN 3 39,064,579 (GRCm39) missense probably damaging 1.00
IGL02487:Fat4 APN 3 38,941,394 (GRCm39) missense probably damaging 1.00
IGL02632:Fat4 APN 3 39,056,913 (GRCm39) missense probably benign 0.04
IGL02665:Fat4 APN 3 39,056,985 (GRCm39) missense probably benign 0.08
IGL02674:Fat4 APN 3 39,037,486 (GRCm39) missense probably benign 0.35
IGL02692:Fat4 APN 3 39,005,235 (GRCm39) missense probably damaging 1.00
IGL02710:Fat4 APN 3 38,944,744 (GRCm39) missense probably damaging 1.00
IGL02803:Fat4 APN 3 38,943,444 (GRCm39) missense probably damaging 1.00
IGL02834:Fat4 APN 3 39,010,893 (GRCm39) missense probably damaging 1.00
IGL02891:Fat4 APN 3 39,005,422 (GRCm39) missense probably damaging 1.00
IGL02982:Fat4 APN 3 38,944,992 (GRCm39) missense probably damaging 1.00
IGL02993:Fat4 APN 3 39,011,304 (GRCm39) missense probably damaging 1.00
IGL02996:Fat4 APN 3 39,012,674 (GRCm39) missense probably damaging 1.00
IGL03029:Fat4 APN 3 39,036,740 (GRCm39) missense possibly damaging 0.46
IGL03124:Fat4 APN 3 39,035,701 (GRCm39) missense possibly damaging 0.61
IGL03144:Fat4 APN 3 39,011,008 (GRCm39) missense possibly damaging 0.68
IGL03149:Fat4 APN 3 39,045,834 (GRCm39) missense probably damaging 1.00
IGL03169:Fat4 APN 3 39,011,547 (GRCm39) missense probably benign 0.02
IGL03190:Fat4 APN 3 39,035,390 (GRCm39) missense probably damaging 1.00
IGL03272:Fat4 APN 3 39,063,852 (GRCm39) missense probably benign
IGL03371:Fat4 APN 3 39,037,336 (GRCm39) missense possibly damaging 0.65
IGL03372:Fat4 APN 3 38,943,283 (GRCm39) missense possibly damaging 0.88
IGL03388:Fat4 APN 3 39,011,376 (GRCm39) missense probably damaging 1.00
IGL03394:Fat4 APN 3 38,946,168 (GRCm39) missense probably damaging 0.99
IGL03394:Fat4 APN 3 39,063,513 (GRCm39) missense probably damaging 1.00
IGL03405:Fat4 APN 3 39,012,599 (GRCm39) missense probably benign 0.02
IGL03410:Fat4 APN 3 38,945,325 (GRCm39) missense probably damaging 1.00
Asahi UTSW 3 39,035,968 (GRCm39) missense probably damaging 1.00
Expulsion UTSW 3 38,943,798 (GRCm39) missense probably benign 0.00
heineken UTSW 3 39,034,529 (GRCm39) missense probably damaging 1.00
schlitz UTSW 3 39,034,808 (GRCm39) missense probably damaging 1.00
PIT4696001:Fat4 UTSW 3 39,036,506 (GRCm39) missense probably damaging 0.98
PIT4696001:Fat4 UTSW 3 38,943,153 (GRCm39) missense probably benign 0.04
R0015:Fat4 UTSW 3 39,036,652 (GRCm39) missense probably damaging 1.00
R0015:Fat4 UTSW 3 39,036,652 (GRCm39) missense probably damaging 1.00
R0078:Fat4 UTSW 3 38,943,080 (GRCm39) missense probably benign 0.35
R0100:Fat4 UTSW 3 39,034,397 (GRCm39) missense probably damaging 1.00
R0100:Fat4 UTSW 3 39,034,397 (GRCm39) missense probably damaging 1.00
R0201:Fat4 UTSW 3 38,945,745 (GRCm39) missense probably damaging 0.99
R0280:Fat4 UTSW 3 38,944,965 (GRCm39) missense probably benign
R0357:Fat4 UTSW 3 38,945,376 (GRCm39) missense probably damaging 1.00
R0409:Fat4 UTSW 3 39,031,562 (GRCm39) missense probably damaging 1.00
R0498:Fat4 UTSW 3 39,034,786 (GRCm39) missense probably benign 0.00
R0502:Fat4 UTSW 3 39,057,073 (GRCm39) missense probably damaging 0.98
R0506:Fat4 UTSW 3 38,942,463 (GRCm39) missense probably benign 0.00
R0532:Fat4 UTSW 3 39,035,870 (GRCm39) missense probably benign 0.02
R0616:Fat4 UTSW 3 38,997,019 (GRCm39) missense probably damaging 1.00
R0630:Fat4 UTSW 3 39,054,321 (GRCm39) missense probably damaging 1.00
R0678:Fat4 UTSW 3 38,943,843 (GRCm39) missense probably damaging 1.00
R0685:Fat4 UTSW 3 39,055,327 (GRCm39) missense probably benign
R0729:Fat4 UTSW 3 39,054,444 (GRCm39) splice site probably benign
R0748:Fat4 UTSW 3 38,941,977 (GRCm39) missense possibly damaging 0.67
R0811:Fat4 UTSW 3 39,011,623 (GRCm39) missense probably damaging 1.00
R0812:Fat4 UTSW 3 39,011,623 (GRCm39) missense probably damaging 1.00
R0830:Fat4 UTSW 3 39,053,258 (GRCm39) missense probably benign 0.26
R0841:Fat4 UTSW 3 39,050,147 (GRCm39) missense probably damaging 0.99
R0884:Fat4 UTSW 3 39,037,007 (GRCm39) missense possibly damaging 0.89
R1056:Fat4 UTSW 3 38,945,541 (GRCm39) missense probably damaging 1.00
R1066:Fat4 UTSW 3 39,011,376 (GRCm39) missense probably damaging 1.00
R1078:Fat4 UTSW 3 39,037,235 (GRCm39) missense probably benign 0.10
R1084:Fat4 UTSW 3 39,033,974 (GRCm39) missense possibly damaging 0.88
R1118:Fat4 UTSW 3 39,037,091 (GRCm39) missense possibly damaging 0.88
R1213:Fat4 UTSW 3 38,944,520 (GRCm39) missense probably benign 0.01
R1418:Fat4 UTSW 3 38,944,962 (GRCm39) missense probably damaging 1.00
R1475:Fat4 UTSW 3 38,942,472 (GRCm39) missense probably damaging 1.00
R1487:Fat4 UTSW 3 39,050,066 (GRCm39) missense possibly damaging 0.77
R1511:Fat4 UTSW 3 39,037,225 (GRCm39) missense probably damaging 0.97
R1534:Fat4 UTSW 3 38,944,238 (GRCm39) missense probably damaging 1.00
R1558:Fat4 UTSW 3 38,943,135 (GRCm39) missense probably damaging 1.00
R1586:Fat4 UTSW 3 38,943,009 (GRCm39) missense probably damaging 1.00
R1592:Fat4 UTSW 3 39,061,326 (GRCm39) missense probably damaging 0.99
R1655:Fat4 UTSW 3 39,011,467 (GRCm39) missense probably damaging 0.97
R1662:Fat4 UTSW 3 39,034,928 (GRCm39) missense probably damaging 1.00
R1710:Fat4 UTSW 3 39,005,304 (GRCm39) missense probably damaging 1.00
R1731:Fat4 UTSW 3 38,945,459 (GRCm39) missense probably damaging 1.00
R1761:Fat4 UTSW 3 38,941,638 (GRCm39) missense possibly damaging 0.61
R1770:Fat4 UTSW 3 39,064,417 (GRCm39) missense probably damaging 1.00
R1828:Fat4 UTSW 3 39,037,607 (GRCm39) missense probably damaging 1.00
R1835:Fat4 UTSW 3 39,037,720 (GRCm39) missense probably benign 0.00
R1846:Fat4 UTSW 3 39,036,532 (GRCm39) missense probably benign 0.00
R1861:Fat4 UTSW 3 39,064,633 (GRCm39) missense probably benign 0.09
R1871:Fat4 UTSW 3 39,035,221 (GRCm39) missense possibly damaging 0.63
R1981:Fat4 UTSW 3 39,045,813 (GRCm39) missense probably damaging 1.00
R1988:Fat4 UTSW 3 39,050,239 (GRCm39) missense probably damaging 1.00
R1988:Fat4 UTSW 3 38,941,264 (GRCm39) missense probably benign
R2056:Fat4 UTSW 3 38,945,319 (GRCm39) missense possibly damaging 0.88
R2058:Fat4 UTSW 3 38,945,319 (GRCm39) missense possibly damaging 0.88
R2059:Fat4 UTSW 3 38,945,319 (GRCm39) missense possibly damaging 0.88
R2070:Fat4 UTSW 3 39,064,804 (GRCm39) missense probably benign 0.00
R2078:Fat4 UTSW 3 38,943,822 (GRCm39) missense probably damaging 1.00
R2114:Fat4 UTSW 3 39,035,633 (GRCm39) missense probably benign 0.01
R2135:Fat4 UTSW 3 39,034,882 (GRCm39) missense probably damaging 0.98
R2152:Fat4 UTSW 3 39,037,544 (GRCm39) missense probably damaging 1.00
R2153:Fat4 UTSW 3 39,037,544 (GRCm39) missense probably damaging 1.00
R2154:Fat4 UTSW 3 38,941,688 (GRCm39) missense probably damaging 1.00
R2196:Fat4 UTSW 3 39,035,566 (GRCm39) missense probably benign 0.23
R2211:Fat4 UTSW 3 38,945,676 (GRCm39) missense possibly damaging 0.77
R2219:Fat4 UTSW 3 39,064,364 (GRCm39) missense probably damaging 1.00
R2247:Fat4 UTSW 3 38,946,198 (GRCm39) missense probably damaging 1.00
R2263:Fat4 UTSW 3 38,943,138 (GRCm39) missense possibly damaging 0.93
R2264:Fat4 UTSW 3 38,944,571 (GRCm39) missense probably benign 0.25
R2274:Fat4 UTSW 3 39,050,048 (GRCm39) missense possibly damaging 0.47
R2337:Fat4 UTSW 3 39,034,160 (GRCm39) missense probably damaging 1.00
R2343:Fat4 UTSW 3 39,011,254 (GRCm39) missense probably damaging 0.97
R2365:Fat4 UTSW 3 39,034,568 (GRCm39) missense probably benign
R2412:Fat4 UTSW 3 39,011,221 (GRCm39) missense probably benign 0.05
R2883:Fat4 UTSW 3 39,034,953 (GRCm39) missense probably damaging 1.00
R2942:Fat4 UTSW 3 39,036,485 (GRCm39) missense probably damaging 1.00
R2989:Fat4 UTSW 3 39,061,302 (GRCm39) missense probably benign
R3103:Fat4 UTSW 3 38,946,089 (GRCm39) missense probably benign 0.03
R3158:Fat4 UTSW 3 38,944,940 (GRCm39) missense possibly damaging 0.87
R3800:Fat4 UTSW 3 39,035,423 (GRCm39) missense possibly damaging 0.48
R3808:Fat4 UTSW 3 39,036,587 (GRCm39) missense possibly damaging 0.52
R3848:Fat4 UTSW 3 39,061,410 (GRCm39) missense probably benign 0.10
R3850:Fat4 UTSW 3 39,061,410 (GRCm39) missense probably benign 0.10
R3957:Fat4 UTSW 3 39,036,495 (GRCm39) missense probably benign
R4065:Fat4 UTSW 3 39,063,346 (GRCm39) missense probably benign 0.13
R4078:Fat4 UTSW 3 39,034,169 (GRCm39) missense probably damaging 1.00
R4096:Fat4 UTSW 3 38,942,024 (GRCm39) missense possibly damaging 0.46
R4161:Fat4 UTSW 3 38,996,958 (GRCm39) missense possibly damaging 0.95
R4273:Fat4 UTSW 3 38,945,776 (GRCm39) missense probably damaging 1.00
R4285:Fat4 UTSW 3 38,943,320 (GRCm39) missense probably benign 0.00
R4288:Fat4 UTSW 3 38,945,912 (GRCm39) missense probably damaging 1.00
R4407:Fat4 UTSW 3 39,012,689 (GRCm39) missense probably benign 0.05
R4528:Fat4 UTSW 3 38,945,443 (GRCm39) missense probably benign 0.01
R4547:Fat4 UTSW 3 39,005,432 (GRCm39) missense probably damaging 1.00
R4681:Fat4 UTSW 3 38,941,491 (GRCm39) missense probably damaging 1.00
R4826:Fat4 UTSW 3 39,037,106 (GRCm39) missense probably damaging 1.00
R4855:Fat4 UTSW 3 38,942,466 (GRCm39) missense probably benign
R4871:Fat4 UTSW 3 38,945,754 (GRCm39) missense probably damaging 1.00
R4897:Fat4 UTSW 3 39,034,781 (GRCm39) missense probably damaging 1.00
R4928:Fat4 UTSW 3 39,064,614 (GRCm39) missense probably damaging 1.00
R4932:Fat4 UTSW 3 39,061,352 (GRCm39) missense probably benign 0.00
R4941:Fat4 UTSW 3 39,011,601 (GRCm39) missense probably damaging 1.00
R4943:Fat4 UTSW 3 39,034,322 (GRCm39) missense probably benign 0.19
R4959:Fat4 UTSW 3 39,037,195 (GRCm39) missense probably benign 0.00
R4973:Fat4 UTSW 3 39,037,195 (GRCm39) missense probably benign 0.00
R5098:Fat4 UTSW 3 38,942,438 (GRCm39) missense probably benign 0.34
R5163:Fat4 UTSW 3 39,034,946 (GRCm39) missense probably damaging 1.00
R5213:Fat4 UTSW 3 39,034,340 (GRCm39) missense possibly damaging 0.56
R5328:Fat4 UTSW 3 39,011,017 (GRCm39) missense probably damaging 1.00
R5337:Fat4 UTSW 3 39,064,527 (GRCm39) missense probably benign 0.44
R5337:Fat4 UTSW 3 38,945,776 (GRCm39) missense probably damaging 1.00
R5363:Fat4 UTSW 3 38,942,154 (GRCm39) missense probably damaging 1.00
R5380:Fat4 UTSW 3 38,943,013 (GRCm39) missense probably damaging 1.00
R5384:Fat4 UTSW 3 39,050,095 (GRCm39) missense possibly damaging 0.87
R5422:Fat4 UTSW 3 38,941,394 (GRCm39) missense possibly damaging 0.92
R5436:Fat4 UTSW 3 38,945,495 (GRCm39) missense probably benign 0.00
R5443:Fat4 UTSW 3 39,064,519 (GRCm39) missense probably damaging 1.00
R5501:Fat4 UTSW 3 38,941,364 (GRCm39) missense probably benign 0.09
R5571:Fat4 UTSW 3 39,064,423 (GRCm39) missense probably damaging 1.00
R5625:Fat4 UTSW 3 38,943,083 (GRCm39) missense possibly damaging 0.78
R5652:Fat4 UTSW 3 39,057,117 (GRCm39) missense probably damaging 0.99
R5725:Fat4 UTSW 3 38,943,774 (GRCm39) missense probably damaging 1.00
R5735:Fat4 UTSW 3 39,003,725 (GRCm39) missense probably damaging 1.00
R5739:Fat4 UTSW 3 39,037,283 (GRCm39) missense probably benign 0.01
R5766:Fat4 UTSW 3 38,943,617 (GRCm39) missense probably damaging 1.00
R5780:Fat4 UTSW 3 39,035,104 (GRCm39) missense probably damaging 0.96
R5811:Fat4 UTSW 3 38,945,936 (GRCm39) missense probably damaging 1.00
R5829:Fat4 UTSW 3 39,061,454 (GRCm39) missense probably damaging 1.00
R5879:Fat4 UTSW 3 38,941,485 (GRCm39) missense probably benign
R5933:Fat4 UTSW 3 39,005,524 (GRCm39) critical splice donor site probably null
R5938:Fat4 UTSW 3 39,005,388 (GRCm39) missense probably damaging 1.00
R5940:Fat4 UTSW 3 38,943,798 (GRCm39) missense probably benign 0.00
R5945:Fat4 UTSW 3 39,037,355 (GRCm39) missense probably benign 0.19
R5963:Fat4 UTSW 3 39,064,696 (GRCm39) missense probably damaging 1.00
R6077:Fat4 UTSW 3 39,056,951 (GRCm39) missense probably damaging 1.00
R6158:Fat4 UTSW 3 39,037,411 (GRCm39) missense possibly damaging 0.95
R6246:Fat4 UTSW 3 38,945,870 (GRCm39) missense probably damaging 1.00
R6253:Fat4 UTSW 3 39,005,505 (GRCm39) missense probably damaging 0.99
R6259:Fat4 UTSW 3 39,061,395 (GRCm39) missense probably benign 0.18
R6295:Fat4 UTSW 3 39,061,229 (GRCm39) splice site probably null
R6387:Fat4 UTSW 3 39,037,934 (GRCm39) missense probably damaging 1.00
R6390:Fat4 UTSW 3 39,034,529 (GRCm39) missense probably damaging 1.00
R6456:Fat4 UTSW 3 39,038,128 (GRCm39) missense possibly damaging 0.90
R6493:Fat4 UTSW 3 38,945,036 (GRCm39) missense probably damaging 1.00
R6500:Fat4 UTSW 3 39,035,418 (GRCm39) nonsense probably null
R6503:Fat4 UTSW 3 39,036,406 (GRCm39) missense probably benign 0.00
R6519:Fat4 UTSW 3 39,057,020 (GRCm39) missense probably benign
R6566:Fat4 UTSW 3 39,011,275 (GRCm39) missense possibly damaging 0.78
R6576:Fat4 UTSW 3 39,033,839 (GRCm39) missense probably benign
R6590:Fat4 UTSW 3 39,037,688 (GRCm39) missense probably damaging 1.00
R6658:Fat4 UTSW 3 38,997,077 (GRCm39) missense probably benign 0.01
R6662:Fat4 UTSW 3 39,010,970 (GRCm39) missense possibly damaging 0.95
R6690:Fat4 UTSW 3 39,037,688 (GRCm39) missense probably damaging 1.00
R6807:Fat4 UTSW 3 39,036,589 (GRCm39) missense probably benign 0.18
R6823:Fat4 UTSW 3 39,038,088 (GRCm39) missense probably benign 0.05
R6824:Fat4 UTSW 3 39,011,674 (GRCm39) missense probably benign 0.00
R6830:Fat4 UTSW 3 39,035,966 (GRCm39) missense probably benign 0.00
R6925:Fat4 UTSW 3 39,050,353 (GRCm39) critical splice donor site probably null
R6948:Fat4 UTSW 3 39,063,595 (GRCm39) missense probably damaging 1.00
R6970:Fat4 UTSW 3 39,050,120 (GRCm39) missense probably damaging 1.00
R6970:Fat4 UTSW 3 39,035,924 (GRCm39) missense probably damaging 1.00
R7017:Fat4 UTSW 3 38,945,692 (GRCm39) missense probably benign
R7030:Fat4 UTSW 3 39,036,107 (GRCm39) missense probably damaging 1.00
R7044:Fat4 UTSW 3 39,064,960 (GRCm39) missense probably benign 0.02
R7044:Fat4 UTSW 3 39,064,959 (GRCm39) missense probably benign
R7045:Fat4 UTSW 3 38,942,750 (GRCm39) missense probably benign 0.01
R7094:Fat4 UTSW 3 38,944,023 (GRCm39) missense probably damaging 1.00
R7111:Fat4 UTSW 3 39,064,682 (GRCm39) missense probably damaging 1.00
R7130:Fat4 UTSW 3 39,034,936 (GRCm39) missense probably damaging 0.99
R7168:Fat4 UTSW 3 39,034,808 (GRCm39) missense probably damaging 1.00
R7192:Fat4 UTSW 3 39,034,613 (GRCm39) missense probably benign 0.04
R7194:Fat4 UTSW 3 39,038,044 (GRCm39) missense probably damaging 1.00
R7194:Fat4 UTSW 3 38,943,033 (GRCm39) missense probably damaging 1.00
R7199:Fat4 UTSW 3 39,031,511 (GRCm39) missense probably damaging 0.98
R7213:Fat4 UTSW 3 39,053,236 (GRCm39) missense possibly damaging 0.63
R7216:Fat4 UTSW 3 38,945,192 (GRCm39) missense probably damaging 1.00
R7225:Fat4 UTSW 3 39,034,325 (GRCm39) missense possibly damaging 0.50
R7238:Fat4 UTSW 3 38,944,562 (GRCm39) missense probably benign 0.31
R7239:Fat4 UTSW 3 39,037,989 (GRCm39) missense possibly damaging 0.85
R7283:Fat4 UTSW 3 38,943,842 (GRCm39) missense probably damaging 1.00
R7296:Fat4 UTSW 3 38,943,294 (GRCm39) nonsense probably null
R7372:Fat4 UTSW 3 38,944,358 (GRCm39) missense probably damaging 1.00
R7400:Fat4 UTSW 3 38,942,073 (GRCm39) missense probably damaging 1.00
R7419:Fat4 UTSW 3 39,054,385 (GRCm39) missense probably damaging 1.00
R7430:Fat4 UTSW 3 39,063,793 (GRCm39) missense probably damaging 1.00
R7430:Fat4 UTSW 3 38,941,599 (GRCm39) missense probably damaging 0.97
R7431:Fat4 UTSW 3 39,063,306 (GRCm39) missense possibly damaging 0.80
R7486:Fat4 UTSW 3 39,011,576 (GRCm39) nonsense probably null
R7501:Fat4 UTSW 3 39,012,597 (GRCm39) nonsense probably null
R7533:Fat4 UTSW 3 39,061,406 (GRCm39) missense probably benign 0.43
R7542:Fat4 UTSW 3 39,035,770 (GRCm39) missense possibly damaging 0.64
R7542:Fat4 UTSW 3 39,035,504 (GRCm39) missense possibly damaging 0.56
R7548:Fat4 UTSW 3 39,035,263 (GRCm39) missense probably benign 0.13
R7567:Fat4 UTSW 3 38,943,485 (GRCm39) missense probably damaging 1.00
R7644:Fat4 UTSW 3 39,064,390 (GRCm39) missense possibly damaging 0.64
R7660:Fat4 UTSW 3 39,035,309 (GRCm39) missense probably benign
R7665:Fat4 UTSW 3 38,943,327 (GRCm39) missense probably benign 0.00
R7676:Fat4 UTSW 3 38,945,846 (GRCm39) missense probably damaging 0.98
R7832:Fat4 UTSW 3 39,055,353 (GRCm39) missense probably benign 0.00
R7848:Fat4 UTSW 3 38,942,000 (GRCm39) missense probably benign
R7883:Fat4 UTSW 3 39,035,968 (GRCm39) missense probably damaging 1.00
R7892:Fat4 UTSW 3 39,003,588 (GRCm39) critical splice acceptor site probably null
R7904:Fat4 UTSW 3 38,941,690 (GRCm39) missense probably damaging 1.00
R7952:Fat4 UTSW 3 38,945,870 (GRCm39) missense probably damaging 0.98
R8015:Fat4 UTSW 3 39,036,065 (GRCm39) missense possibly damaging 0.79
R8040:Fat4 UTSW 3 39,035,815 (GRCm39) missense probably damaging 1.00
R8142:Fat4 UTSW 3 38,945,352 (GRCm39) missense probably damaging 1.00
R8151:Fat4 UTSW 3 38,946,203 (GRCm39) missense probably damaging 0.99
R8163:Fat4 UTSW 3 39,033,881 (GRCm39) missense possibly damaging 0.88
R8317:Fat4 UTSW 3 39,012,659 (GRCm39) missense possibly damaging 0.80
R8413:Fat4 UTSW 3 39,063,128 (GRCm39) critical splice acceptor site probably null
R8447:Fat4 UTSW 3 39,033,824 (GRCm39) missense possibly damaging 0.88
R8458:Fat4 UTSW 3 39,035,702 (GRCm39) missense probably benign 0.25
R8509:Fat4 UTSW 3 39,036,052 (GRCm39) missense probably benign
R8543:Fat4 UTSW 3 39,031,643 (GRCm39) missense probably damaging 1.00
R8679:Fat4 UTSW 3 39,064,842 (GRCm39) missense probably damaging 1.00
R8726:Fat4 UTSW 3 39,064,647 (GRCm39) missense probably damaging 1.00
R8743:Fat4 UTSW 3 38,942,592 (GRCm39) missense probably benign 0.16
R8751:Fat4 UTSW 3 38,946,002 (GRCm39) missense probably benign 0.01
R8779:Fat4 UTSW 3 39,033,898 (GRCm39) missense probably damaging 1.00
R8797:Fat4 UTSW 3 39,053,278 (GRCm39) missense probably benign 0.01
R8860:Fat4 UTSW 3 38,946,269 (GRCm39) missense probably benign 0.26
R8955:Fat4 UTSW 3 39,037,778 (GRCm39) missense probably benign 0.01
R9053:Fat4 UTSW 3 38,941,324 (GRCm39) nonsense probably null
R9071:Fat4 UTSW 3 39,037,598 (GRCm39) missense probably benign 0.29
R9088:Fat4 UTSW 3 39,061,448 (GRCm39) missense probably benign 0.02
R9100:Fat4 UTSW 3 39,064,803 (GRCm39) missense
R9180:Fat4 UTSW 3 38,942,556 (GRCm39) missense possibly damaging 0.78
R9184:Fat4 UTSW 3 39,036,592 (GRCm39) missense probably damaging 0.99
R9201:Fat4 UTSW 3 38,945,079 (GRCm39) missense probably damaging 1.00
R9206:Fat4 UTSW 3 39,063,390 (GRCm39) missense probably damaging 0.99
R9268:Fat4 UTSW 3 38,942,396 (GRCm39) missense probably damaging 1.00
R9278:Fat4 UTSW 3 38,945,171 (GRCm39) missense probably benign 0.44
R9287:Fat4 UTSW 3 38,945,781 (GRCm39) missense probably damaging 0.98
R9355:Fat4 UTSW 3 39,036,047 (GRCm39) missense probably damaging 1.00
R9437:Fat4 UTSW 3 38,945,417 (GRCm39) missense probably benign 0.00
R9455:Fat4 UTSW 3 38,945,412 (GRCm39) missense
R9456:Fat4 UTSW 3 38,942,571 (GRCm39) missense possibly damaging 0.50
R9476:Fat4 UTSW 3 39,037,886 (GRCm39) missense probably benign 0.04
R9510:Fat4 UTSW 3 39,037,886 (GRCm39) missense probably benign 0.04
R9511:Fat4 UTSW 3 39,034,802 (GRCm39) missense probably damaging 0.98
R9540:Fat4 UTSW 3 39,063,346 (GRCm39) missense probably benign
R9568:Fat4 UTSW 3 38,946,156 (GRCm39) missense probably damaging 1.00
R9683:Fat4 UTSW 3 38,943,332 (GRCm39) missense possibly damaging 0.52
R9711:Fat4 UTSW 3 39,055,374 (GRCm39) missense probably benign 0.00
X0017:Fat4 UTSW 3 39,063,255 (GRCm39) missense probably benign 0.00
X0019:Fat4 UTSW 3 39,035,189 (GRCm39) missense probably damaging 1.00
X0020:Fat4 UTSW 3 39,054,300 (GRCm39) missense probably damaging 1.00
X0024:Fat4 UTSW 3 38,997,051 (GRCm39) missense probably benign 0.43
X0064:Fat4 UTSW 3 39,024,901 (GRCm39) missense probably damaging 1.00
Z1088:Fat4 UTSW 3 39,012,641 (GRCm39) missense probably benign 0.00
Z1088:Fat4 UTSW 3 38,941,199 (GRCm39) missense possibly damaging 0.88
Z1176:Fat4 UTSW 3 39,037,964 (GRCm39) missense probably damaging 1.00
Z1176:Fat4 UTSW 3 39,037,508 (GRCm39) missense probably benign 0.00
Z1177:Fat4 UTSW 3 38,944,496 (GRCm39) missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38,942,733 (GRCm39) missense probably damaging 1.00
Z1177:Fat4 UTSW 3 39,035,987 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTTCACATCACAGTCACTG -3'
(R):5'- CTTGGGGCGTTCTCCATAAC -3'

Sequencing Primer
(F):5'- TCGTTCACATCACAGTCACTGAAGAG -3'
(R):5'- GGGCGTTCTCCATAACAGTTG -3'
Posted On 2022-10-06