Incidental Mutation 'R9647:Depdc5'
ID 726789
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene Name DEP domain containing 5
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9647 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 33021045-33151580 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 33081567 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 576 (H576Q)
Ref Sequence ENSEMBL: ENSMUSP00000113862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000124780] [ENSMUST00000195980]
AlphaFold P61460
Predicted Effect possibly damaging
Transcript: ENSMUST00000049780
AA Change: H576Q

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: H576Q

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087897
AA Change: H576Q

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: H576Q

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119705
AA Change: H576Q

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: H576Q

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120902
AA Change: H576Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: H576Q

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124780
AA Change: H6Q

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120120
Gene: ENSMUSG00000037426
AA Change: H6Q

DomainStartEndE-ValueType
low complexity region 179 189 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
SCOP:d1fsha_ 519 586 1e-13 SMART
Blast:DEP 537 589 2e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137169
SMART Domains Protein: ENSMUSP00000121089
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
low complexity region 224 234 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
DEP 560 635 2.49e-15 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195980
SMART Domains Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 147 4e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C A 16: 20,195,310 (GRCm39) R729L probably benign Het
Actr3b T C 5: 26,037,408 (GRCm39) S295P probably benign Het
Alb G A 5: 90,620,544 (GRCm39) probably null Het
Ank2 T A 3: 126,792,623 (GRCm39) N756I possibly damaging Het
Ankar A G 1: 72,689,307 (GRCm39) Y1275H probably damaging Het
Ankrd11 C T 8: 123,617,682 (GRCm39) A2057T probably benign Het
Birc6 G A 17: 74,999,305 (GRCm39) V4678M probably damaging Het
Bmpr1a A G 14: 34,136,694 (GRCm39) V499A probably benign Het
Ccdc142 A G 6: 83,079,259 (GRCm39) N199D probably benign Het
Ccdc179 G T 7: 51,663,311 (GRCm39) Y38* probably null Het
Cdhr2 A T 13: 54,867,394 (GRCm39) M438L probably benign Het
Cfap74 A T 4: 155,549,373 (GRCm39) Q78L unknown Het
Crocc A T 4: 140,774,335 (GRCm39) S155T probably benign Het
Dhx30 A T 9: 109,922,214 (GRCm39) L156Q probably damaging Het
Dido1 T A 2: 180,315,068 (GRCm39) T795S probably benign Het
Dlx1 T C 2: 71,360,476 (GRCm39) S47P probably benign Het
Dspp G A 5: 104,323,636 (GRCm39) A260T possibly damaging Het
Ephx2 T C 14: 66,326,957 (GRCm39) T413A probably benign Het
Erp44 A C 4: 48,205,166 (GRCm39) L276V probably benign Het
Fastkd5 T A 2: 130,457,729 (GRCm39) Q287L probably damaging Het
Foxh1 T A 15: 76,553,460 (GRCm39) H114L possibly damaging Het
Fry A T 5: 150,292,984 (GRCm39) L410F probably damaging Het
Gamt T A 10: 80,095,672 (GRCm39) H86L probably damaging Het
Gdpd5 G T 7: 99,104,241 (GRCm39) R483L probably benign Het
Gm17067 A C 7: 42,357,569 (GRCm39) V311G probably benign Het
Gpatch2 C T 1: 187,054,542 (GRCm39) T422I probably damaging Het
Gpi1 A G 7: 33,901,879 (GRCm39) I546T probably damaging Het
Gyg1 A C 3: 20,177,007 (GRCm39) S328A probably benign Het
Heatr1 T A 13: 12,441,679 (GRCm39) V1491E probably benign Het
Hrob A T 11: 102,146,586 (GRCm39) Q287H possibly damaging Het
Ildr2 T C 1: 166,137,038 (GRCm39) S626P probably benign Het
Insr T G 8: 3,205,874 (GRCm39) E1305A probably benign Het
Iqca1 T A 1: 89,998,258 (GRCm39) T572S probably benign Het
Kdm4a A T 4: 118,003,790 (GRCm39) M762K probably benign Het
Kdm4a T A 4: 118,017,399 (GRCm39) T556S probably benign Het
Lama1 A G 17: 68,024,170 (GRCm39) I89M Het
Larp7 T C 3: 127,334,211 (GRCm39) K539E probably damaging Het
Mmadhc C A 2: 50,186,482 (GRCm39) probably benign Het
Mmp2 A G 8: 93,567,114 (GRCm39) D478G probably damaging Het
Nat10 T C 2: 103,578,538 (GRCm39) Q222R probably benign Het
Nlgn1 A T 3: 25,488,182 (GRCm39) Y718N probably damaging Het
Nlrp5 A T 7: 23,107,576 (GRCm39) E83V probably benign Het
Odc1 T C 12: 17,598,614 (GRCm39) V218A possibly damaging Het
Or10al4 A T 17: 38,037,796 (GRCm39) I294F probably damaging Het
Or11g26 G C 14: 50,753,552 (GRCm39) R297T probably damaging Het
Or9r3 A G 10: 129,948,029 (GRCm39) I210T probably damaging Het
Oxsr1 G A 9: 119,083,932 (GRCm39) S324F probably damaging Het
Pclo C T 5: 14,731,788 (GRCm39) T304M Het
Pgghg A G 7: 140,526,743 (GRCm39) R687G possibly damaging Het
Plxna4 A G 6: 32,228,044 (GRCm39) S521P probably damaging Het
Rasgrp4 A G 7: 28,839,917 (GRCm39) S172G probably damaging Het
Rora A G 9: 69,255,450 (GRCm39) D78G probably damaging Het
Sec1 G T 7: 45,328,556 (GRCm39) R164S probably benign Het
Sesn3 A G 9: 14,225,999 (GRCm39) N245D probably benign Het
Slc44a5 T A 3: 153,953,370 (GRCm39) W251R possibly damaging Het
Ssr2 T C 3: 88,487,206 (GRCm39) V7A possibly damaging Het
Syne2 A G 12: 76,151,875 (GRCm39) D1912G possibly damaging Het
Tcea2 C A 2: 181,322,984 (GRCm39) T1N probably benign Het
Tmem131l T C 3: 83,836,018 (GRCm39) Y697C probably damaging Het
Tmx4 T C 2: 134,481,588 (GRCm39) M112V probably benign Het
Tom1 G T 8: 75,785,495 (GRCm39) A330S probably benign Het
Trip4 A T 9: 65,765,616 (GRCm39) L361* probably null Het
Trmt9b T C 8: 36,979,210 (GRCm39) I271T probably benign Het
Trp73 T G 4: 154,165,788 (GRCm39) T142P probably damaging Het
Trpm5 T A 7: 142,634,498 (GRCm39) D683V possibly damaging Het
Trpm7 T C 2: 126,667,562 (GRCm39) I810V probably damaging Het
Trps1 A T 15: 50,524,944 (GRCm39) S995R probably benign Het
Ttn C A 2: 76,608,269 (GRCm39) E17885* probably null Het
Uggt2 A T 14: 119,256,312 (GRCm39) Y1120N probably damaging Het
Unc13a A T 8: 72,104,882 (GRCm39) N793K probably damaging Het
Vcf1 T C 11: 113,568,146 (GRCm39) D103G probably damaging Het
Vmn2r94 T C 17: 18,463,884 (GRCm39) H802R probably benign Het
Vmn2r-ps158 T C 7: 42,697,171 (GRCm39) C743R probably damaging Het
Zdhhc5 A T 2: 84,524,750 (GRCm39) M190K probably benign Het
Zfp719 A T 7: 43,233,602 (GRCm39) N7I possibly damaging Het
Zfp735 A G 11: 73,580,600 (GRCm39) Y33C probably damaging Het
Zgrf1 C T 3: 127,355,251 (GRCm39) T159I probably benign Het
Zzef1 A T 11: 72,760,651 (GRCm39) T1325S probably benign Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 33,125,158 (GRCm39) splice site probably null
IGL01019:Depdc5 APN 5 33,050,745 (GRCm39) missense probably damaging 0.96
IGL01067:Depdc5 APN 5 33,056,411 (GRCm39) splice site probably null
IGL01405:Depdc5 APN 5 33,095,033 (GRCm39) missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 33,113,241 (GRCm39) missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 33,081,544 (GRCm39) missense probably damaging 1.00
IGL01998:Depdc5 APN 5 33,102,495 (GRCm39) splice site probably benign
IGL02025:Depdc5 APN 5 33,103,976 (GRCm39) critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 33,061,145 (GRCm39) missense probably damaging 1.00
IGL02537:Depdc5 APN 5 33,125,131 (GRCm39) missense probably damaging 1.00
IGL02812:Depdc5 APN 5 33,050,712 (GRCm39) splice site probably benign
IGL03001:Depdc5 APN 5 33,102,434 (GRCm39) missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 33,026,157 (GRCm39) unclassified probably benign
alligator UTSW 5 33,121,851 (GRCm39) splice site probably null
lagarto UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
sauros UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
IGL02988:Depdc5 UTSW 5 33,113,511 (GRCm39) splice site probably null
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0153:Depdc5 UTSW 5 33,091,281 (GRCm39) splice site probably benign
R0179:Depdc5 UTSW 5 33,058,918 (GRCm39) unclassified probably benign
R0212:Depdc5 UTSW 5 33,069,586 (GRCm39) missense probably benign 0.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0302:Depdc5 UTSW 5 33,061,890 (GRCm39) critical splice donor site probably benign
R0511:Depdc5 UTSW 5 33,102,372 (GRCm39) nonsense probably null
R0677:Depdc5 UTSW 5 33,058,814 (GRCm39) missense probably damaging 1.00
R0884:Depdc5 UTSW 5 33,075,322 (GRCm39) missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 33,034,418 (GRCm39) missense probably damaging 1.00
R1611:Depdc5 UTSW 5 33,148,297 (GRCm39) missense probably damaging 1.00
R1687:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 33,075,286 (GRCm39) missense probably benign 0.24
R1903:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 33,061,175 (GRCm39) missense probably damaging 1.00
R1997:Depdc5 UTSW 5 33,059,250 (GRCm39) critical splice donor site probably null
R2079:Depdc5 UTSW 5 33,104,018 (GRCm39) missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 33,148,125 (GRCm39) nonsense probably null
R2291:Depdc5 UTSW 5 33,136,746 (GRCm39) missense probably damaging 1.00
R2422:Depdc5 UTSW 5 33,148,379 (GRCm39) missense probably damaging 1.00
R2851:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2852:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2937:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2938:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2974:Depdc5 UTSW 5 33,091,361 (GRCm39) critical splice donor site probably null
R3884:Depdc5 UTSW 5 33,101,421 (GRCm39) missense probably damaging 1.00
R3967:Depdc5 UTSW 5 33,101,459 (GRCm39) nonsense probably null
R4118:Depdc5 UTSW 5 33,121,979 (GRCm39) missense probably damaging 1.00
R4197:Depdc5 UTSW 5 33,148,547 (GRCm39) missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 33,061,878 (GRCm39) critical splice donor site probably null
R4534:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 33,141,290 (GRCm39) missense probably damaging 1.00
R4613:Depdc5 UTSW 5 33,132,790 (GRCm39) missense probably damaging 1.00
R4736:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4738:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4765:Depdc5 UTSW 5 33,094,979 (GRCm39) missense probably damaging 1.00
R5021:Depdc5 UTSW 5 33,136,758 (GRCm39) missense probably damaging 1.00
R5259:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5261:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5541:Depdc5 UTSW 5 33,021,973 (GRCm39) utr 5 prime probably benign
R5594:Depdc5 UTSW 5 33,058,834 (GRCm39) missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 33,132,850 (GRCm39) nonsense probably null
R6132:Depdc5 UTSW 5 33,067,811 (GRCm39) missense probably damaging 0.99
R6146:Depdc5 UTSW 5 33,126,075 (GRCm39) missense probably benign 0.01
R6336:Depdc5 UTSW 5 33,121,851 (GRCm39) splice site probably null
R6468:Depdc5 UTSW 5 33,069,575 (GRCm39) missense probably benign 0.02
R6911:Depdc5 UTSW 5 33,081,536 (GRCm39) missense probably damaging 1.00
R6969:Depdc5 UTSW 5 33,141,204 (GRCm39) missense probably damaging 1.00
R7002:Depdc5 UTSW 5 33,034,502 (GRCm39) splice site probably null
R7066:Depdc5 UTSW 5 33,059,192 (GRCm39) missense probably benign 0.08
R7231:Depdc5 UTSW 5 33,059,209 (GRCm39) missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 33,125,089 (GRCm39) missense probably benign
R7302:Depdc5 UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
R7386:Depdc5 UTSW 5 33,085,280 (GRCm39) missense probably benign
R7564:Depdc5 UTSW 5 33,058,854 (GRCm39) missense probably damaging 1.00
R7636:Depdc5 UTSW 5 33,075,327 (GRCm39) missense probably benign
R7795:Depdc5 UTSW 5 33,101,447 (GRCm39) missense probably damaging 1.00
R7845:Depdc5 UTSW 5 33,061,259 (GRCm39) splice site probably null
R8013:Depdc5 UTSW 5 33,131,186 (GRCm39) missense probably benign 0.01
R8037:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8038:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8065:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 33,102,393 (GRCm39) missense probably benign 0.01
R8112:Depdc5 UTSW 5 33,126,050 (GRCm39) missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 33,094,981 (GRCm39) missense probably damaging 1.00
R8382:Depdc5 UTSW 5 33,085,242 (GRCm39) missense probably benign 0.00
R8680:Depdc5 UTSW 5 33,101,382 (GRCm39) missense possibly damaging 0.48
R8743:Depdc5 UTSW 5 33,081,587 (GRCm39) missense probably benign 0.10
R8754:Depdc5 UTSW 5 33,136,881 (GRCm39) missense probably benign 0.00
R9157:Depdc5 UTSW 5 33,102,452 (GRCm39) missense probably damaging 0.98
R9364:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9441:Depdc5 UTSW 5 33,095,042 (GRCm39) missense probably benign 0.03
R9450:Depdc5 UTSW 5 33,091,354 (GRCm39) missense probably benign
R9459:Depdc5 UTSW 5 33,148,117 (GRCm39) missense probably damaging 0.99
R9554:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9569:Depdc5 UTSW 5 33,025,321 (GRCm39) missense probably damaging 0.98
R9688:Depdc5 UTSW 5 33,055,276 (GRCm39) nonsense probably null
X0027:Depdc5 UTSW 5 33,061,636 (GRCm39) missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 33,100,626 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGGGACAGGTCTTCAGAATACATG -3'
(R):5'- CTAGTGCTAAGGACCAGAGCTAG -3'

Sequencing Primer
(F):5'- TTTACTCGTTTCTCTTACTTGTGAG -3'
(R):5'- GAGCTAGGAACCCACAGGC -3'
Posted On 2022-10-06