Incidental Mutation 'R9647:Depdc5'
ID 726789
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene Name DEP domain containing 5
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9647 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 32863701-32994236 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 32924223 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 576 (H576Q)
Ref Sequence ENSEMBL: ENSMUSP00000113862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000124780] [ENSMUST00000195980]
AlphaFold P61460
Predicted Effect possibly damaging
Transcript: ENSMUST00000049780
AA Change: H576Q

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: H576Q

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087897
AA Change: H576Q

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: H576Q

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119705
AA Change: H576Q

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: H576Q

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120902
AA Change: H576Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: H576Q

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124780
AA Change: H6Q

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120120
Gene: ENSMUSG00000037426
AA Change: H6Q

DomainStartEndE-ValueType
low complexity region 179 189 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
SCOP:d1fsha_ 519 586 1e-13 SMART
Blast:DEP 537 589 2e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137169
SMART Domains Protein: ENSMUSP00000121089
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
low complexity region 224 234 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
DEP 560 635 2.49e-15 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195980
SMART Domains Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 147 4e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015G11Rik G T 7: 52,013,563 Y38* probably null Het
6430573F11Rik T C 8: 36,512,056 I271T probably benign Het
Abcc5 C A 16: 20,376,560 R729L probably benign Het
Actr3b T C 5: 25,832,410 S295P probably benign Het
Alb G A 5: 90,472,685 probably null Het
Ank2 T A 3: 126,998,974 N756I possibly damaging Het
Ankar A G 1: 72,650,148 Y1275H probably damaging Het
Ankrd11 C T 8: 122,890,943 A2057T probably benign Het
BC030867 A T 11: 102,255,760 Q287H possibly damaging Het
Birc6 G A 17: 74,692,310 V4678M probably damaging Het
Bmpr1a A G 14: 34,414,737 V499A probably benign Het
Ccdc142 A G 6: 83,102,278 N199D probably benign Het
Cdhr2 A T 13: 54,719,581 M438L probably benign Het
Cfap74 A T 4: 155,464,916 Q78L unknown Het
Crocc A T 4: 141,047,024 S155T probably benign Het
Dhx30 A T 9: 110,093,146 L156Q probably damaging Het
Dido1 T A 2: 180,673,275 T795S probably benign Het
Dlx1 T C 2: 71,530,132 S47P probably benign Het
Dspp G A 5: 104,175,770 A260T possibly damaging Het
Ephx2 T C 14: 66,089,508 T413A probably benign Het
Erp44 A C 4: 48,205,166 L276V probably benign Het
Fam104a T C 11: 113,677,320 D103G probably damaging Het
Fastkd5 T A 2: 130,615,809 Q287L probably damaging Het
Foxh1 T A 15: 76,669,260 H114L possibly damaging Het
Fry A T 5: 150,369,519 L410F probably damaging Het
Gamt T A 10: 80,259,838 H86L probably damaging Het
Gdpd5 G T 7: 99,455,034 R483L probably benign Het
Gm17067 A C 7: 42,708,145 V311G probably benign Het
Gm9268 T C 7: 43,047,747 C743R probably damaging Het
Gpatch2 C T 1: 187,322,345 T422I probably damaging Het
Gpi1 A G 7: 34,202,454 I546T probably damaging Het
Gyg A C 3: 20,122,843 S328A probably benign Het
Heatr1 T A 13: 12,426,798 V1491E probably benign Het
Ildr2 T C 1: 166,309,469 S626P probably benign Het
Insr T G 8: 3,155,874 E1305A probably benign Het
Iqca T A 1: 90,070,536 T572S probably benign Het
Kdm4a A T 4: 118,146,593 M762K probably benign Het
Kdm4a T A 4: 118,160,202 T556S probably benign Het
Lama1 A G 17: 67,717,175 I89M Het
Larp7 T C 3: 127,540,562 K539E probably damaging Het
Mmadhc C A 2: 50,296,470 probably benign Het
Mmp2 A G 8: 92,840,486 D478G probably damaging Het
Nat10 T C 2: 103,748,193 Q222R probably benign Het
Nlgn1 A T 3: 25,434,018 Y718N probably damaging Het
Nlrp5 A T 7: 23,408,151 E83V probably benign Het
Odc1 T C 12: 17,548,613 V218A possibly damaging Het
Olfr120 A T 17: 37,726,905 I294F probably damaging Het
Olfr742 G C 14: 50,516,095 R297T probably damaging Het
Olfr823 A G 10: 130,112,160 I210T probably damaging Het
Oxsr1 G A 9: 119,254,866 S324F probably damaging Het
Pclo C T 5: 14,681,774 T304M Het
Pgghg A G 7: 140,946,830 R687G possibly damaging Het
Plxna4 A G 6: 32,251,109 S521P probably damaging Het
Rasgrp4 A G 7: 29,140,492 S172G probably damaging Het
Rora A G 9: 69,348,168 D78G probably damaging Het
Sec1 G T 7: 45,679,132 R164S probably benign Het
Sesn3 A G 9: 14,314,703 N245D probably benign Het
Slc44a5 T A 3: 154,247,733 W251R possibly damaging Het
Ssr2 T C 3: 88,579,899 V7A possibly damaging Het
Syne2 A G 12: 76,105,101 D1912G possibly damaging Het
Tcea2 C A 2: 181,681,191 T1N probably benign Het
Tmem131l T C 3: 83,928,711 Y697C probably damaging Het
Tmx4 T C 2: 134,639,668 M112V probably benign Het
Tom1 G T 8: 75,058,867 A330S probably benign Het
Trip4 A T 9: 65,858,334 L361* probably null Het
Trp73 T G 4: 154,081,331 T142P probably damaging Het
Trpm5 T A 7: 143,080,761 D683V possibly damaging Het
Trpm7 T C 2: 126,825,642 I810V probably damaging Het
Trps1 A T 15: 50,661,548 S995R probably benign Het
Ttn C A 2: 76,777,925 E17885* probably null Het
Uggt2 A T 14: 119,018,900 Y1120N probably damaging Het
Unc13a A T 8: 71,652,238 N793K probably damaging Het
Vmn2r94 T C 17: 18,243,622 H802R probably benign Het
Zdhhc5 A T 2: 84,694,406 M190K probably benign Het
Zfp719 A T 7: 43,584,178 N7I possibly damaging Het
Zfp735 A G 11: 73,689,774 Y33C probably damaging Het
Zgrf1 C T 3: 127,561,602 T159I probably benign Het
Zzef1 A T 11: 72,869,825 T1325S probably benign Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 32967814 splice site probably null
IGL01019:Depdc5 APN 5 32893401 missense probably damaging 0.96
IGL01067:Depdc5 APN 5 32899067 splice site probably null
IGL01405:Depdc5 APN 5 32937689 missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 32955897 missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 32924200 missense probably damaging 1.00
IGL01998:Depdc5 APN 5 32945151 splice site probably benign
IGL02025:Depdc5 APN 5 32946632 critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 32903801 missense probably damaging 1.00
IGL02537:Depdc5 APN 5 32967787 missense probably damaging 1.00
IGL02812:Depdc5 APN 5 32893368 splice site probably benign
IGL03001:Depdc5 APN 5 32945090 missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 32868813 unclassified probably benign
alligator UTSW 5 32964507 splice site probably null
lagarto UTSW 5 32979508 missense probably damaging 1.00
sauros UTSW 5 32986966 missense possibly damaging 0.92
IGL02988:Depdc5 UTSW 5 32956167 splice site probably null
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0153:Depdc5 UTSW 5 32933937 splice site probably benign
R0179:Depdc5 UTSW 5 32901574 unclassified probably benign
R0212:Depdc5 UTSW 5 32912242 missense probably benign 0.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0302:Depdc5 UTSW 5 32904546 critical splice donor site probably benign
R0511:Depdc5 UTSW 5 32945028 nonsense probably null
R0677:Depdc5 UTSW 5 32901470 missense probably damaging 1.00
R0884:Depdc5 UTSW 5 32917978 missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 32986966 missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 32877074 missense probably damaging 1.00
R1611:Depdc5 UTSW 5 32990953 missense probably damaging 1.00
R1687:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 32917942 missense probably benign 0.24
R1903:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 32903831 missense probably damaging 1.00
R1997:Depdc5 UTSW 5 32901906 critical splice donor site probably null
R2079:Depdc5 UTSW 5 32946674 missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 32990781 nonsense probably null
R2291:Depdc5 UTSW 5 32979402 missense probably damaging 1.00
R2422:Depdc5 UTSW 5 32991035 missense probably damaging 1.00
R2851:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2852:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2937:Depdc5 UTSW 5 32901621 splice site probably null
R2938:Depdc5 UTSW 5 32901621 splice site probably null
R2974:Depdc5 UTSW 5 32934017 critical splice donor site probably null
R3884:Depdc5 UTSW 5 32944077 missense probably damaging 1.00
R3967:Depdc5 UTSW 5 32944115 nonsense probably null
R4118:Depdc5 UTSW 5 32964635 missense probably damaging 1.00
R4197:Depdc5 UTSW 5 32991203 missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 32904534 critical splice donor site probably null
R4534:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 32983946 missense probably damaging 1.00
R4613:Depdc5 UTSW 5 32975446 missense probably damaging 1.00
R4736:Depdc5 UTSW 5 32975322 missense probably benign
R4738:Depdc5 UTSW 5 32975322 missense probably benign
R4765:Depdc5 UTSW 5 32937635 missense probably damaging 1.00
R5021:Depdc5 UTSW 5 32979414 missense probably damaging 1.00
R5259:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5261:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5541:Depdc5 UTSW 5 32864629 utr 5 prime probably benign
R5594:Depdc5 UTSW 5 32901490 missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 32975506 nonsense probably null
R6132:Depdc5 UTSW 5 32910467 missense probably damaging 0.99
R6146:Depdc5 UTSW 5 32968731 missense probably benign 0.01
R6336:Depdc5 UTSW 5 32964507 splice site probably null
R6468:Depdc5 UTSW 5 32912231 missense probably benign 0.02
R6911:Depdc5 UTSW 5 32924192 missense probably damaging 1.00
R6969:Depdc5 UTSW 5 32983860 missense probably damaging 1.00
R7002:Depdc5 UTSW 5 32877158 splice site probably null
R7066:Depdc5 UTSW 5 32901848 missense probably benign 0.08
R7231:Depdc5 UTSW 5 32901865 missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 32967745 missense probably benign
R7302:Depdc5 UTSW 5 32979508 missense probably damaging 1.00
R7386:Depdc5 UTSW 5 32927936 missense probably benign
R7564:Depdc5 UTSW 5 32901510 missense probably damaging 1.00
R7636:Depdc5 UTSW 5 32917983 missense probably benign
R7795:Depdc5 UTSW 5 32944103 missense probably damaging 1.00
R7845:Depdc5 UTSW 5 32903915 splice site probably null
R8013:Depdc5 UTSW 5 32973842 missense probably benign 0.01
R8037:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8038:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8065:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 32945049 missense probably benign 0.01
R8112:Depdc5 UTSW 5 32968706 missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 32937637 missense probably damaging 1.00
R8382:Depdc5 UTSW 5 32927898 missense probably benign 0.00
R8680:Depdc5 UTSW 5 32944038 missense possibly damaging 0.48
R8743:Depdc5 UTSW 5 32924243 missense probably benign 0.10
R8754:Depdc5 UTSW 5 32979537 missense probably benign 0.00
R9157:Depdc5 UTSW 5 32945108 missense probably damaging 0.98
R9364:Depdc5 UTSW 5 32964732 missense probably benign
R9441:Depdc5 UTSW 5 32937698 missense probably benign 0.03
R9450:Depdc5 UTSW 5 32934010 missense probably benign
R9459:Depdc5 UTSW 5 32990773 missense probably damaging 0.99
R9554:Depdc5 UTSW 5 32964732 missense probably benign
R9569:Depdc5 UTSW 5 32867977 missense probably damaging 0.98
R9688:Depdc5 UTSW 5 32897932 nonsense probably null
X0027:Depdc5 UTSW 5 32904292 missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 32943282 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGGGACAGGTCTTCAGAATACATG -3'
(R):5'- CTAGTGCTAAGGACCAGAGCTAG -3'

Sequencing Primer
(F):5'- TTTACTCGTTTCTCTTACTTGTGAG -3'
(R):5'- GAGCTAGGAACCCACAGGC -3'
Posted On 2022-10-06