Incidental Mutation 'R9647:Uggt2'
ID 726830
Institutional Source Beutler Lab
Gene Symbol Uggt2
Ensembl Gene ENSMUSG00000042104
Gene Name UDP-glucose glycoprotein glucosyltransferase 2
Synonyms 3110001A05Rik, A230065J02Rik, 3110027P15Rik, 1810064L21Rik, Ugcgl2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R9647 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 119222451-119336842 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119256312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 1120 (Y1120N)
Ref Sequence ENSEMBL: ENSMUSP00000121249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127153] [ENSMUST00000156203]
AlphaFold E9Q4X2
Predicted Effect probably benign
Transcript: ENSMUST00000127153
SMART Domains Protein: ENSMUSP00000117738
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
low complexity region 327 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153693
SMART Domains Protein: ENSMUSP00000123327
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
Pfam:UDP-g_GGTase 1 106 3.3e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156203
AA Change: Y1120N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121249
Gene: ENSMUSG00000042104
AA Change: Y1120N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDP-g_GGTase 23 1189 N/A PFAM
SCOP:d1ga8a_ 1219 1485 9e-44 SMART
Blast:BROMO 1377 1427 4e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173391
SMART Domains Protein: ENSMUSP00000133772
Gene: ENSMUSG00000042104

DomainStartEndE-ValueType
Pfam:UDP-g_GGTase 2 63 9.4e-18 PFAM
SCOP:d1ga8a_ 77 216 3e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C A 16: 20,195,310 (GRCm39) R729L probably benign Het
Actr3b T C 5: 26,037,408 (GRCm39) S295P probably benign Het
Alb G A 5: 90,620,544 (GRCm39) probably null Het
Ank2 T A 3: 126,792,623 (GRCm39) N756I possibly damaging Het
Ankar A G 1: 72,689,307 (GRCm39) Y1275H probably damaging Het
Ankrd11 C T 8: 123,617,682 (GRCm39) A2057T probably benign Het
Birc6 G A 17: 74,999,305 (GRCm39) V4678M probably damaging Het
Bmpr1a A G 14: 34,136,694 (GRCm39) V499A probably benign Het
Ccdc142 A G 6: 83,079,259 (GRCm39) N199D probably benign Het
Ccdc179 G T 7: 51,663,311 (GRCm39) Y38* probably null Het
Cdhr2 A T 13: 54,867,394 (GRCm39) M438L probably benign Het
Cfap74 A T 4: 155,549,373 (GRCm39) Q78L unknown Het
Crocc A T 4: 140,774,335 (GRCm39) S155T probably benign Het
Depdc5 T A 5: 33,081,567 (GRCm39) H576Q possibly damaging Het
Dhx30 A T 9: 109,922,214 (GRCm39) L156Q probably damaging Het
Dido1 T A 2: 180,315,068 (GRCm39) T795S probably benign Het
Dlx1 T C 2: 71,360,476 (GRCm39) S47P probably benign Het
Dspp G A 5: 104,323,636 (GRCm39) A260T possibly damaging Het
Ephx2 T C 14: 66,326,957 (GRCm39) T413A probably benign Het
Erp44 A C 4: 48,205,166 (GRCm39) L276V probably benign Het
Fastkd5 T A 2: 130,457,729 (GRCm39) Q287L probably damaging Het
Foxh1 T A 15: 76,553,460 (GRCm39) H114L possibly damaging Het
Fry A T 5: 150,292,984 (GRCm39) L410F probably damaging Het
Gamt T A 10: 80,095,672 (GRCm39) H86L probably damaging Het
Gdpd5 G T 7: 99,104,241 (GRCm39) R483L probably benign Het
Gm17067 A C 7: 42,357,569 (GRCm39) V311G probably benign Het
Gpatch2 C T 1: 187,054,542 (GRCm39) T422I probably damaging Het
Gpi1 A G 7: 33,901,879 (GRCm39) I546T probably damaging Het
Gyg1 A C 3: 20,177,007 (GRCm39) S328A probably benign Het
Heatr1 T A 13: 12,441,679 (GRCm39) V1491E probably benign Het
Hrob A T 11: 102,146,586 (GRCm39) Q287H possibly damaging Het
Ildr2 T C 1: 166,137,038 (GRCm39) S626P probably benign Het
Insr T G 8: 3,205,874 (GRCm39) E1305A probably benign Het
Iqca1 T A 1: 89,998,258 (GRCm39) T572S probably benign Het
Kdm4a A T 4: 118,003,790 (GRCm39) M762K probably benign Het
Kdm4a T A 4: 118,017,399 (GRCm39) T556S probably benign Het
Lama1 A G 17: 68,024,170 (GRCm39) I89M Het
Larp7 T C 3: 127,334,211 (GRCm39) K539E probably damaging Het
Mmadhc C A 2: 50,186,482 (GRCm39) probably benign Het
Mmp2 A G 8: 93,567,114 (GRCm39) D478G probably damaging Het
Nat10 T C 2: 103,578,538 (GRCm39) Q222R probably benign Het
Nlgn1 A T 3: 25,488,182 (GRCm39) Y718N probably damaging Het
Nlrp5 A T 7: 23,107,576 (GRCm39) E83V probably benign Het
Odc1 T C 12: 17,598,614 (GRCm39) V218A possibly damaging Het
Or10al4 A T 17: 38,037,796 (GRCm39) I294F probably damaging Het
Or11g26 G C 14: 50,753,552 (GRCm39) R297T probably damaging Het
Or9r3 A G 10: 129,948,029 (GRCm39) I210T probably damaging Het
Oxsr1 G A 9: 119,083,932 (GRCm39) S324F probably damaging Het
Pclo C T 5: 14,731,788 (GRCm39) T304M Het
Pgghg A G 7: 140,526,743 (GRCm39) R687G possibly damaging Het
Plxna4 A G 6: 32,228,044 (GRCm39) S521P probably damaging Het
Rasgrp4 A G 7: 28,839,917 (GRCm39) S172G probably damaging Het
Rora A G 9: 69,255,450 (GRCm39) D78G probably damaging Het
Sec1 G T 7: 45,328,556 (GRCm39) R164S probably benign Het
Sesn3 A G 9: 14,225,999 (GRCm39) N245D probably benign Het
Slc44a5 T A 3: 153,953,370 (GRCm39) W251R possibly damaging Het
Ssr2 T C 3: 88,487,206 (GRCm39) V7A possibly damaging Het
Syne2 A G 12: 76,151,875 (GRCm39) D1912G possibly damaging Het
Tcea2 C A 2: 181,322,984 (GRCm39) T1N probably benign Het
Tmem131l T C 3: 83,836,018 (GRCm39) Y697C probably damaging Het
Tmx4 T C 2: 134,481,588 (GRCm39) M112V probably benign Het
Tom1 G T 8: 75,785,495 (GRCm39) A330S probably benign Het
Trip4 A T 9: 65,765,616 (GRCm39) L361* probably null Het
Trmt9b T C 8: 36,979,210 (GRCm39) I271T probably benign Het
Trp73 T G 4: 154,165,788 (GRCm39) T142P probably damaging Het
Trpm5 T A 7: 142,634,498 (GRCm39) D683V possibly damaging Het
Trpm7 T C 2: 126,667,562 (GRCm39) I810V probably damaging Het
Trps1 A T 15: 50,524,944 (GRCm39) S995R probably benign Het
Ttn C A 2: 76,608,269 (GRCm39) E17885* probably null Het
Unc13a A T 8: 72,104,882 (GRCm39) N793K probably damaging Het
Vcf1 T C 11: 113,568,146 (GRCm39) D103G probably damaging Het
Vmn2r94 T C 17: 18,463,884 (GRCm39) H802R probably benign Het
Vmn2r-ps158 T C 7: 42,697,171 (GRCm39) C743R probably damaging Het
Zdhhc5 A T 2: 84,524,750 (GRCm39) M190K probably benign Het
Zfp719 A T 7: 43,233,602 (GRCm39) N7I possibly damaging Het
Zfp735 A G 11: 73,580,600 (GRCm39) Y33C probably damaging Het
Zgrf1 C T 3: 127,355,251 (GRCm39) T159I probably benign Het
Zzef1 A T 11: 72,760,651 (GRCm39) T1325S probably benign Het
Other mutations in Uggt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Uggt2 APN 14 119,286,688 (GRCm39) missense possibly damaging 0.94
IGL00430:Uggt2 APN 14 119,263,841 (GRCm39) nonsense probably null
IGL00433:Uggt2 APN 14 119,250,899 (GRCm39) missense probably benign
IGL00572:Uggt2 APN 14 119,280,203 (GRCm39) missense probably benign 0.02
IGL00577:Uggt2 APN 14 119,272,312 (GRCm39) missense possibly damaging 0.89
IGL00671:Uggt2 APN 14 119,280,211 (GRCm39) missense possibly damaging 0.73
IGL01482:Uggt2 APN 14 119,295,057 (GRCm39) missense probably damaging 1.00
IGL01630:Uggt2 APN 14 119,280,184 (GRCm39) missense probably benign 0.00
IGL01787:Uggt2 APN 14 119,319,146 (GRCm39) missense probably damaging 0.99
IGL02063:Uggt2 APN 14 119,326,605 (GRCm39) missense possibly damaging 0.79
IGL02809:Uggt2 APN 14 119,328,150 (GRCm39) missense probably benign 0.17
IGL02894:Uggt2 APN 14 119,319,211 (GRCm39) missense probably damaging 0.96
IGL03062:Uggt2 APN 14 119,312,758 (GRCm39) missense probably damaging 1.00
IGL03139:Uggt2 APN 14 119,332,722 (GRCm39) missense probably benign 0.25
IGL03142:Uggt2 APN 14 119,235,603 (GRCm39) missense probably damaging 1.00
IGL03168:Uggt2 APN 14 119,315,080 (GRCm39) missense probably damaging 0.98
IGL03348:Uggt2 APN 14 119,308,300 (GRCm39) missense probably benign 0.38
P0014:Uggt2 UTSW 14 119,281,950 (GRCm39) missense probably damaging 1.00
R0006:Uggt2 UTSW 14 119,287,075 (GRCm39) missense probably benign 0.07
R0063:Uggt2 UTSW 14 119,244,542 (GRCm39) splice site probably benign
R0063:Uggt2 UTSW 14 119,244,542 (GRCm39) splice site probably benign
R0383:Uggt2 UTSW 14 119,286,863 (GRCm39) missense probably damaging 1.00
R0433:Uggt2 UTSW 14 119,312,741 (GRCm39) critical splice donor site probably null
R0472:Uggt2 UTSW 14 119,332,748 (GRCm39) missense probably damaging 1.00
R0609:Uggt2 UTSW 14 119,332,748 (GRCm39) missense probably damaging 1.00
R0645:Uggt2 UTSW 14 119,295,010 (GRCm39) missense probably benign 0.27
R0788:Uggt2 UTSW 14 119,332,812 (GRCm39) splice site probably benign
R0940:Uggt2 UTSW 14 119,328,604 (GRCm39) critical splice donor site probably null
R1567:Uggt2 UTSW 14 119,246,505 (GRCm39) missense possibly damaging 0.58
R1627:Uggt2 UTSW 14 119,295,075 (GRCm39) missense possibly damaging 0.95
R1682:Uggt2 UTSW 14 119,292,055 (GRCm39) missense probably benign 0.19
R1746:Uggt2 UTSW 14 119,250,915 (GRCm39) missense probably benign 0.00
R1785:Uggt2 UTSW 14 119,298,788 (GRCm39) missense probably damaging 1.00
R1786:Uggt2 UTSW 14 119,298,788 (GRCm39) missense probably damaging 1.00
R1799:Uggt2 UTSW 14 119,269,688 (GRCm39) missense probably benign 0.00
R1894:Uggt2 UTSW 14 119,287,130 (GRCm39) missense probably damaging 0.99
R1918:Uggt2 UTSW 14 119,245,467 (GRCm39) splice site probably benign
R2149:Uggt2 UTSW 14 119,312,757 (GRCm39) missense probably benign 0.02
R2168:Uggt2 UTSW 14 119,256,917 (GRCm39) missense probably damaging 1.00
R2219:Uggt2 UTSW 14 119,312,749 (GRCm39) missense probably damaging 1.00
R2220:Uggt2 UTSW 14 119,312,749 (GRCm39) missense probably damaging 1.00
R2240:Uggt2 UTSW 14 119,232,461 (GRCm39) missense probably damaging 1.00
R2331:Uggt2 UTSW 14 119,264,011 (GRCm39) missense possibly damaging 0.87
R2904:Uggt2 UTSW 14 119,296,521 (GRCm39) missense possibly damaging 0.74
R2906:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2907:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2908:Uggt2 UTSW 14 119,256,919 (GRCm39) missense probably benign 0.00
R2998:Uggt2 UTSW 14 119,286,797 (GRCm39) missense probably damaging 1.00
R3407:Uggt2 UTSW 14 119,328,682 (GRCm39) missense probably benign 0.39
R3722:Uggt2 UTSW 14 119,278,930 (GRCm39) missense probably damaging 1.00
R3749:Uggt2 UTSW 14 119,295,084 (GRCm39) missense probably benign 0.13
R4015:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4016:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4017:Uggt2 UTSW 14 119,263,845 (GRCm39) missense possibly damaging 0.47
R4206:Uggt2 UTSW 14 119,286,674 (GRCm39) missense probably damaging 1.00
R4536:Uggt2 UTSW 14 119,256,970 (GRCm39) missense probably benign
R4642:Uggt2 UTSW 14 119,272,347 (GRCm39) missense probably benign 0.00
R4654:Uggt2 UTSW 14 119,269,670 (GRCm39) missense possibly damaging 0.46
R4770:Uggt2 UTSW 14 119,266,466 (GRCm39) splice site probably null
R4810:Uggt2 UTSW 14 119,250,933 (GRCm39) missense probably damaging 1.00
R4832:Uggt2 UTSW 14 119,239,259 (GRCm39) missense probably damaging 0.99
R4856:Uggt2 UTSW 14 119,273,376 (GRCm39) splice site probably null
R4886:Uggt2 UTSW 14 119,273,376 (GRCm39) splice site probably null
R4888:Uggt2 UTSW 14 119,315,062 (GRCm39) critical splice donor site probably null
R4888:Uggt2 UTSW 14 119,286,665 (GRCm39) missense probably damaging 1.00
R4895:Uggt2 UTSW 14 119,256,298 (GRCm39) missense probably damaging 1.00
R5353:Uggt2 UTSW 14 119,319,182 (GRCm39) missense probably benign 0.00
R5423:Uggt2 UTSW 14 119,256,898 (GRCm39) missense probably damaging 1.00
R5476:Uggt2 UTSW 14 119,328,121 (GRCm39) missense probably benign 0.01
R5561:Uggt2 UTSW 14 119,278,939 (GRCm39) missense probably benign 0.02
R5607:Uggt2 UTSW 14 119,326,611 (GRCm39) missense possibly damaging 0.81
R5608:Uggt2 UTSW 14 119,326,611 (GRCm39) missense possibly damaging 0.81
R5625:Uggt2 UTSW 14 119,315,136 (GRCm39) missense probably damaging 1.00
R5698:Uggt2 UTSW 14 119,280,138 (GRCm39) missense probably damaging 1.00
R5986:Uggt2 UTSW 14 119,286,838 (GRCm39) missense probably damaging 1.00
R6031:Uggt2 UTSW 14 119,308,238 (GRCm39) missense probably benign 0.06
R6031:Uggt2 UTSW 14 119,308,238 (GRCm39) missense probably benign 0.06
R6056:Uggt2 UTSW 14 119,273,381 (GRCm39) critical splice donor site probably null
R6289:Uggt2 UTSW 14 119,279,014 (GRCm39) missense probably damaging 0.99
R6480:Uggt2 UTSW 14 119,294,976 (GRCm39) missense probably benign 0.01
R6515:Uggt2 UTSW 14 119,315,131 (GRCm39) missense possibly damaging 0.89
R6706:Uggt2 UTSW 14 119,308,293 (GRCm39) missense probably damaging 1.00
R6745:Uggt2 UTSW 14 119,280,022 (GRCm39) missense possibly damaging 0.58
R6819:Uggt2 UTSW 14 119,263,847 (GRCm39) missense probably damaging 1.00
R6879:Uggt2 UTSW 14 119,239,271 (GRCm39) missense probably benign 0.10
R7117:Uggt2 UTSW 14 119,251,938 (GRCm39) missense probably benign 0.25
R7183:Uggt2 UTSW 14 119,257,049 (GRCm39) splice site probably null
R7337:Uggt2 UTSW 14 119,323,587 (GRCm39) missense probably benign 0.28
R7342:Uggt2 UTSW 14 119,232,384 (GRCm39) missense possibly damaging 0.56
R7615:Uggt2 UTSW 14 119,326,681 (GRCm39) missense probably benign 0.12
R7625:Uggt2 UTSW 14 119,263,905 (GRCm39) missense probably damaging 1.00
R7685:Uggt2 UTSW 14 119,312,759 (GRCm39) missense probably damaging 1.00
R7842:Uggt2 UTSW 14 119,235,516 (GRCm39) missense probably damaging 1.00
R7891:Uggt2 UTSW 14 119,280,059 (GRCm39) missense probably benign 0.09
R7938:Uggt2 UTSW 14 119,296,519 (GRCm39) missense possibly damaging 0.68
R8050:Uggt2 UTSW 14 119,263,834 (GRCm39) missense probably damaging 0.98
R9007:Uggt2 UTSW 14 119,326,724 (GRCm39) missense probably damaging 1.00
R9080:Uggt2 UTSW 14 119,295,017 (GRCm39) missense probably benign 0.42
R9203:Uggt2 UTSW 14 119,294,975 (GRCm39) missense probably benign 0.08
R9215:Uggt2 UTSW 14 119,279,006 (GRCm39) missense probably damaging 1.00
R9324:Uggt2 UTSW 14 119,312,741 (GRCm39) critical splice donor site probably null
R9459:Uggt2 UTSW 14 119,286,595 (GRCm39) missense probably benign 0.02
R9781:Uggt2 UTSW 14 119,232,384 (GRCm39) missense possibly damaging 0.56
Z1177:Uggt2 UTSW 14 119,244,708 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAATAGATAAGTCCTCAAAAGCC -3'
(R):5'- AATTGAGTCAGGAATGATGAAGTCC -3'

Sequencing Primer
(F):5'- CTGTTATCCTGTTGAAAACCAGATC -3'
(R):5'- GATGAAGTCCTATCTCAAAACATGG -3'
Posted On 2022-10-06