Mutagenetix > Incidental Mutation

Incidental Mutation 'R9648:Sall2'

726894

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9648 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52313767 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 657 (F657S)

Ref Sequence

ENSEMBL: ENSMUSP00000056401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably damaging
Transcript: ENSMUST00000058326
AA Change: F657S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: F657S

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135523
AA Change: F655S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgra2	G	A	8: 27,119,144	V798M	probably damaging	Het
Adprhl1	A	G	8: 13,223,245	L1171P	probably benign	Het
Atp2b2	C	T	6: 113,803,746		probably null	Het
Birc6	A	T	17: 74,631,701	N2701Y	probably damaging	Het
Bptf	A	T	11: 107,052,894	N2720K	probably damaging	Het
Ccpg1	T	C	9: 73,012,030	L309S	probably damaging	Het
Cep295	T	C	9: 15,323,607	N2126S	probably benign	Het
Cln5	A	G	14: 103,076,298	T329A	probably benign	Het
Cmas	T	A	6: 142,771,209	L276M	probably benign	Het
Cnbd1	A	C	4: 19,098,142		probably null	Het
Depdc1b	A	G	13: 108,323,910	N18S	probably damaging	Het
Dido1	C	A	2: 180,660,675	R1812I	probably damaging	Het
Dnajc2	G	A	5: 21,763,480	T403M	probably damaging	Het
Dnm1	T	A	2: 32,340,443	I120F	probably damaging	Het
Egfl6	C	T	X: 166,536,239	V379I	probably benign	Het
Foxa2	T	A	2: 148,045,879	K12M	probably damaging	Het
Fut7	T	A	2: 25,425,324	V198E	probably damaging	Het
Gm21731	C	T	13: 120,240,959	P97L	possibly damaging	Het
Gramd1b	A	T	9: 40,333,497	V205E	probably damaging	Het
Gtf2i	T	A	5: 134,255,916	N510Y	probably damaging	Het
H2-M1	T	C	17: 36,671,356	I118V	probably benign	Het
Icam1	T	C	9: 21,026,401	F245L	probably damaging	Het
Ifna16	C	T	4: 88,676,823	A12T	probably benign	Het
Il12rb2	T	C	6: 67,356,603	T231A	probably benign	Het
Klrb1a	T	C	6: 128,609,853		probably null	Het
Mc3r	T	C	2: 172,249,719	L287P	probably damaging	Het
Mettl7a3	C	T	15: 100,334,976	A16V	probably benign	Het
Mme	A	T	3: 63,301,005	I63L	probably benign	Het
Msh3	A	G	13: 92,342,249	V404A	probably benign	Het
Myrf	T	A	19: 10,210,646	I896F	possibly damaging	Het
Nup205	T	A	6: 35,225,811	Y1318N	probably benign	Het
Olfr328	A	T	11: 58,551,487	Y251N	probably damaging	Het
Olfr829	T	A	9: 18,857,452	S267T	possibly damaging	Het
Osbp	T	A	19: 11,966,226	W96R	probably damaging	Het
Pcf11	A	G	7: 92,658,110	L950P	probably damaging	Het
Pcnt	T	C	10: 76,354,255	T2816A	probably benign	Het
Pde7a	A	G	3: 19,256,802	Y87H	probably damaging	Het
Pip4k2c	T	C	10: 127,205,700	H163R	probably damaging	Het
Pld1	T	A	3: 28,120,751	L846Q	probably damaging	Het
Plppr2	T	A	9: 21,941,083	S113T	probably benign	Het
Pms1	A	T	1: 53,275,125	L87Q	probably damaging	Het
Rasa1	A	G	13: 85,288,571	S113P	possibly damaging	Het
Rexo1	T	A	10: 80,549,706	H506L	probably damaging	Het
Rps12	T	C	10: 23,786,879	I6V	probably benign	Het
Rsph3a	T	C	17: 7,952,563	M170T	probably benign	Het
Rsrc2	A	G	5: 123,739,625	S156P	unknown	Het
Rtp3	T	C	9: 110,986,518	T260A	probably benign	Het
Serpind1	T	A	16: 17,336,454	N48K	probably benign	Het
Slc38a11	T	A	2: 65,358,140	D95V	probably benign	Het
Slc5a4a	T	C	10: 76,166,774	C255R	probably damaging	Het
Slc6a12	C	A	6: 121,358,702	Y330*	probably null	Het
Slco1b2	T	C	6: 141,656,929	Y203H	possibly damaging	Het
Spdye4a	C	T	5: 143,225,093	R74K	probably benign	Het
Stab2	ACC	AC	10: 86,856,697		probably null	Het
Stat1	A	T	1: 52,126,536	D97V	probably damaging	Het
Stk11ip	A	G	1: 75,528,941	E418G	probably damaging	Het
Tcf20	T	C	15: 82,855,675	D525G	probably damaging	Het
Tlr2	A	T	3: 83,838,533	L81Q	probably damaging	Het
Trim50	T	A	5: 135,366,621	I277N	probably damaging	Het
Ttn	T	A	2: 76,789,462	Q15954L	probably benign	Het
Unc13d	AATGCCTCCCATGCC	AATGCCTCCCATGCCTCCCATGCC	11: 116,068,172		probably benign	Het
Wdr43	A	G	17: 71,653,499	K592R	probably benign	Het
Xirp2	A	G	2: 67,516,255	I2947V	probably benign	Het
Zan	A	C	5: 137,407,730	F3746V	unknown	Het
Zfp418	G	A	7: 7,182,172	S378N	probably benign	Het
Zfp518b	C	G	5: 38,672,897	Q588H	probably damaging	Het
Zfp959	G	A	17: 55,897,212	R83K	possibly damaging	Het
Znrf3	G	A	11: 5,281,915	R437C	probably damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1079:Sall2	UTSW	14	52313203	missense	probably benign	0.13
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- CACCTTCAGAAAGTGCGGAAC -3'
(R):5'- AGCTAGTAGAAAAGATTGACCGCC -3'

Sequencing Primer
(F):5'- GAAAGTGCGGAACCCCCATTG -3'
(R):5'- ATTGACCGCCAAGGAGCTG -3'

Posted On

2022-10-06