Incidental Mutation 'R9649:Fam184b'
ID 726938
Institutional Source Beutler Lab
Gene Symbol Fam184b
Ensembl Gene ENSMUSG00000015879
Gene Name family with sequence similarity 184, member B
Synonyms 9630031F12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9649 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 45529705-45639614 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45639142 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 33 (D33G)
Ref Sequence ENSEMBL: ENSMUSP00000016023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016023]
AlphaFold Q0KK56
Predicted Effect probably damaging
Transcript: ENSMUST00000016023
AA Change: D33G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000016023
Gene: ENSMUSG00000015879
AA Change: D33G

DomainStartEndE-ValueType
Pfam:FAM184 50 248 7.7e-28 PFAM
coiled coil region 284 337 N/A INTRINSIC
coiled coil region 387 495 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
coiled coil region 575 620 N/A INTRINSIC
coiled coil region 686 775 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik A T 2: 173,719,913 H5L unknown Het
Aatk A G 11: 120,010,907 S888P probably damaging Het
Ahnak A T 19: 9,008,422 K2357* probably null Het
Arl9 T A 5: 77,007,292 L90Q probably damaging Het
Atxn2 T C 5: 121,810,992 V1144A probably damaging Het
Batf3 C T 1: 191,098,426 probably benign Het
Brpf3 G A 17: 28,818,623 E822K probably benign Het
Cabin1 T A 10: 75,739,405 Q602L probably damaging Het
Cadps T C 14: 12,597,418 E424G probably damaging Het
Camta1 A G 4: 151,131,547 L972P possibly damaging Het
Ccdc159 A G 9: 21,929,376 N80D possibly damaging Het
Cdh1 A C 8: 106,661,972 E553D possibly damaging Het
Cdk14 T A 5: 5,373,477 E35V probably benign Het
Cfap70 A G 14: 20,400,478 L995P probably damaging Het
Col18a1 T A 10: 77,080,839 E334V unknown Het
Colec12 T A 18: 9,877,000 I741K unknown Het
Crot A G 5: 8,974,170 V342A probably benign Het
Ctnnal1 A G 4: 56,865,036 S27P possibly damaging Het
Cyp2j9 A G 4: 96,571,956 S437P probably damaging Het
Dennd4c A T 4: 86,824,923 T1001S probably benign Het
Dffa G A 4: 149,117,819 V227I probably benign Het
Dnaaf5 T A 5: 139,174,154 H602Q probably benign Het
Efcab7 G T 4: 99,904,705 K397N probably damaging Het
Egfl6 C T X: 166,536,239 V379I probably benign Het
Fadd G A 7: 144,580,647 T167I probably benign Het
Fam214a A G 9: 75,017,067 D864G possibly damaging Het
Fam83h G A 15: 76,006,127 R141W probably damaging Het
Fam84a T C 12: 14,150,189 N179S probably benign Het
Fanci G A 7: 79,427,206 R564Q probably damaging Het
Fat3 A T 9: 15,996,758 D2649E possibly damaging Het
Fcrl1 A G 3: 87,384,611 T46A possibly damaging Het
Fig4 C T 10: 41,267,767 G232D probably benign Het
Frem3 A T 8: 80,614,516 H1146L probably damaging Het
Fyttd1 T A 16: 32,895,102 F133L probably benign Het
Gata2 A G 6: 88,202,523 N326D probably damaging Het
Gm10093 A T 17: 78,491,646 Y22F probably benign Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm21964 T C 8: 110,110,948 F375L probably damaging Het
Gm7298 A T 6: 121,787,532 T1457S probably damaging Het
Gm8773 C T 5: 5,575,549 Q82* probably null Het
Heatr5b C T 17: 78,834,095 probably null Het
Hfm1 T A 5: 106,918,463 D33V possibly damaging Het
Hmcn2 G A 2: 31,402,438 A2447T possibly damaging Het
Hs3st3b1 A G 11: 63,921,505 F128S probably benign Het
Hs3st6 G T 17: 24,753,252 R56L possibly damaging Het
Hsd17b3 C T 13: 64,064,357 M168I probably damaging Het
Ighv1-34 G T 12: 114,851,265 D92E possibly damaging Het
Itgb4 A T 11: 115,994,345 I1018F possibly damaging Het
Itih3 T C 14: 30,915,648 D518G possibly damaging Het
Kcnma1 C T 14: 23,451,598 probably null Het
Klhl11 A T 11: 100,472,680 S17T probably benign Het
Lilra6 T C 7: 3,914,522 E158G possibly damaging Het
Loxl1 A G 9: 58,312,754 W45R probably damaging Het
Lrfn1 G T 7: 28,466,830 V550F probably damaging Het
Lrp1 T C 10: 127,573,499 K1584E probably benign Het
Lrp4 C G 2: 91,508,569 P1782A possibly damaging Het
Map3k1 A G 13: 111,748,944 S1480P probably damaging Het
Mark4 G T 7: 19,426,090 N748K probably benign Het
Mrpl38 G A 11: 116,135,074 T142M probably damaging Het
Mrpl41 T C 2: 24,974,469 T64A probably benign Het
Mrps2 G A 2: 28,469,752 R207K possibly damaging Het
Myo5a A T 9: 75,192,444 E96D Het
Nbas A T 12: 13,583,416 E2274V probably damaging Het
Olfr1022 T C 2: 85,868,934 L114P possibly damaging Het
Olfr1022 T A 2: 85,869,475 N294K probably damaging Het
Olfr1274-ps T C 2: 90,400,994 F111S probably damaging Het
Olfr570 T C 7: 102,900,445 I26T probably benign Het
Olfr616 T C 7: 103,564,643 D212G probably damaging Het
Olfr781 T A 10: 129,333,499 I206N possibly damaging Het
Pcdhga12 T A 18: 37,767,235 D373E probably damaging Het
Pgd A C 4: 149,151,139 F395V probably damaging Het
Pi16 A G 17: 29,319,389 M59V possibly damaging Het
Pik3r5 A T 11: 68,490,894 T255S probably benign Het
Plch2 A T 4: 154,984,059 V1370E probably benign Het
Plec A G 15: 76,182,953 I1309T unknown Het
Ppp2r3d A T 9: 124,440,831 S22R Het
Ptk2b C A 14: 66,175,705 E342* probably null Het
Ptpn23 T C 9: 110,386,158 probably null Het
Rfx8 A C 1: 39,683,690 S256A probably damaging Het
Rnf115 C T 3: 96,758,021 T69I probably damaging Het
Rnf213 A G 11: 119,479,631 Y4753C Het
S100a10 A C 3: 93,564,283 D58A possibly damaging Het
Serpina12 T C 12: 104,038,058 K105R probably benign Het
Slc20a2 G A 8: 22,538,884 G124S probably damaging Het
Stab2 ACC AC 10: 86,856,697 probably null Het
Stard9 C A 2: 120,696,154 T964N probably benign Het
Stxbp5 T A 10: 9,899,194 I72F probably damaging Het
Sumf2 T A 5: 129,862,641 M282K possibly damaging Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tmem185b G T 1: 119,526,883 V125L probably benign Het
Tmtc1 A G 6: 148,243,216 M887T probably damaging Het
Tnfaip8 C T 18: 50,090,445 Q83* probably null Het
Tnks A G 8: 34,838,935 V1162A probably damaging Het
Tomm70a T A 16: 57,140,709 Y342N possibly damaging Het
Tpo T A 12: 30,075,876 D828V probably damaging Het
Ugt8a A T 3: 125,914,689 N257K probably damaging Het
Uhrf1bp1l C A 10: 89,790,731 T429K probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Vim T A 2: 13,574,892 M154K probably damaging Het
Virma G T 4: 11,486,045 M1I probably null Het
Zfp715 A T 7: 43,301,229 M100K probably benign Het
Zfp748 A T 13: 67,542,528 C204* probably null Het
Zmynd8 A T 2: 165,838,852 D236E probably damaging Het
Other mutations in Fam184b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Fam184b APN 5 45539749 missense probably benign 0.17
IGL00781:Fam184b APN 5 45555192 splice site probably null
IGL01636:Fam184b APN 5 45584295 missense probably benign 0.00
IGL02008:Fam184b APN 5 45532823 missense possibly damaging 0.75
IGL02123:Fam184b APN 5 45639151 missense possibly damaging 0.92
IGL02177:Fam184b APN 5 45532815 nonsense probably null
IGL02192:Fam184b APN 5 45537720 missense probably benign 0.00
IGL02478:Fam184b APN 5 45537697 missense probably damaging 0.99
IGL03368:Fam184b APN 5 45531824 missense possibly damaging 0.91
R0003:Fam184b UTSW 5 45555194 splice site probably benign
R0129:Fam184b UTSW 5 45532778 missense probably damaging 1.00
R0420:Fam184b UTSW 5 45584512 missense probably damaging 1.00
R0647:Fam184b UTSW 5 45584590 missense probably benign
R1215:Fam184b UTSW 5 45584178 missense probably damaging 1.00
R1374:Fam184b UTSW 5 45555143 missense probably benign
R1466:Fam184b UTSW 5 45580509 splice site probably benign
R1773:Fam184b UTSW 5 45584334 missense possibly damaging 0.60
R1865:Fam184b UTSW 5 45531889 missense possibly damaging 0.91
R3615:Fam184b UTSW 5 45582815 missense possibly damaging 0.56
R3616:Fam184b UTSW 5 45582815 missense possibly damaging 0.56
R4180:Fam184b UTSW 5 45539764 missense probably benign 0.00
R4375:Fam184b UTSW 5 45542343 missense probably benign
R4674:Fam184b UTSW 5 45582888 nonsense probably null
R4942:Fam184b UTSW 5 45573307 missense probably damaging 0.97
R5021:Fam184b UTSW 5 45573262 missense probably benign 0.01
R5450:Fam184b UTSW 5 45539801 missense probably benign
R5731:Fam184b UTSW 5 45553129 missense probably benign 0.00
R5858:Fam184b UTSW 5 45639119 missense probably damaging 0.99
R6032:Fam184b UTSW 5 45582896 missense probably benign 0.01
R6032:Fam184b UTSW 5 45582896 missense probably benign 0.01
R6060:Fam184b UTSW 5 45553147 missense probably damaging 0.99
R6088:Fam184b UTSW 5 45584012 missense probably damaging 1.00
R6416:Fam184b UTSW 5 45537653 missense probably benign 0.04
R6932:Fam184b UTSW 5 45532901 splice site probably null
R6956:Fam184b UTSW 5 45530757 missense probably damaging 0.97
R6965:Fam184b UTSW 5 45555135 missense probably benign
R7229:Fam184b UTSW 5 45584175 missense probably damaging 1.00
R7303:Fam184b UTSW 5 45542226 critical splice donor site probably null
R7429:Fam184b UTSW 5 45540888 missense probably benign
R7522:Fam184b UTSW 5 45530751 missense probably damaging 1.00
R7541:Fam184b UTSW 5 45542232 missense probably damaging 0.99
R7942:Fam184b UTSW 5 45584253 missense probably benign 0.16
R8172:Fam184b UTSW 5 45584367 missense possibly damaging 0.86
R9470:Fam184b UTSW 5 45584512 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACTCAGATACAGAACAGCTTCC -3'
(R):5'- CACCTCTCTGGAGAAAGCTC -3'

Sequencing Primer
(F):5'- CTCAGATACAGAACAGCTTCCTTTGG -3'
(R):5'- AGAAAGCTCTCACGCCCGTG -3'
Posted On 2022-10-06