Incidental Mutation 'R9649:Stab2'
ID 726972
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Name stabilin 2
Synonyms STAB-2, FEEL-2
MMRRC Submission
Accession Numbers

Genbank: NM_138673; MGI: 2178743

Essential gene? Non essential (E-score: 0.000) question?
Stock # R9649 (G1)
Quality Score 205.468
Status Not validated
Chromosome 10
Chromosomal Location 86841198-87008025 bp(-) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) ACC to AC at 86856697 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
AlphaFold Q8R4U0
Predicted Effect probably null
Transcript: ENSMUST00000035288
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000219341
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik A T 2: 173,719,913 H5L unknown Het
Aatk A G 11: 120,010,907 S888P probably damaging Het
Ahnak A T 19: 9,008,422 K2357* probably null Het
Arl9 T A 5: 77,007,292 L90Q probably damaging Het
Atxn2 T C 5: 121,810,992 V1144A probably damaging Het
Batf3 C T 1: 191,098,426 probably benign Het
Brpf3 G A 17: 28,818,623 E822K probably benign Het
Cabin1 T A 10: 75,739,405 Q602L probably damaging Het
Cadps T C 14: 12,597,418 E424G probably damaging Het
Camta1 A G 4: 151,131,547 L972P possibly damaging Het
Ccdc159 A G 9: 21,929,376 N80D possibly damaging Het
Cdh1 A C 8: 106,661,972 E553D possibly damaging Het
Cdk14 T A 5: 5,373,477 E35V probably benign Het
Cfap70 A G 14: 20,400,478 L995P probably damaging Het
Col18a1 T A 10: 77,080,839 E334V unknown Het
Colec12 T A 18: 9,877,000 I741K unknown Het
Crot A G 5: 8,974,170 V342A probably benign Het
Ctnnal1 A G 4: 56,865,036 S27P possibly damaging Het
Cyp2j9 A G 4: 96,571,956 S437P probably damaging Het
Dennd4c A T 4: 86,824,923 T1001S probably benign Het
Dffa G A 4: 149,117,819 V227I probably benign Het
Dnaaf5 T A 5: 139,174,154 H602Q probably benign Het
Efcab7 G T 4: 99,904,705 K397N probably damaging Het
Egfl6 C T X: 166,536,239 V379I probably benign Het
Fadd G A 7: 144,580,647 T167I probably benign Het
Fam184b T C 5: 45,639,142 D33G probably damaging Het
Fam214a A G 9: 75,017,067 D864G possibly damaging Het
Fam83h G A 15: 76,006,127 R141W probably damaging Het
Fam84a T C 12: 14,150,189 N179S probably benign Het
Fanci G A 7: 79,427,206 R564Q probably damaging Het
Fat3 A T 9: 15,996,758 D2649E possibly damaging Het
Fcrl1 A G 3: 87,384,611 T46A possibly damaging Het
Fig4 C T 10: 41,267,767 G232D probably benign Het
Frem3 A T 8: 80,614,516 H1146L probably damaging Het
Fyttd1 T A 16: 32,895,102 F133L probably benign Het
Gata2 A G 6: 88,202,523 N326D probably damaging Het
Gm10093 A T 17: 78,491,646 Y22F probably benign Het
Gm13084 A G 4: 143,816,039 C4R probably damaging Het
Gm21964 T C 8: 110,110,948 F375L probably damaging Het
Gm7298 A T 6: 121,787,532 T1457S probably damaging Het
Gm8773 C T 5: 5,575,549 Q82* probably null Het
Heatr5b C T 17: 78,834,095 probably null Het
Hfm1 T A 5: 106,918,463 D33V possibly damaging Het
Hmcn2 G A 2: 31,402,438 A2447T possibly damaging Het
Hs3st3b1 A G 11: 63,921,505 F128S probably benign Het
Hs3st6 G T 17: 24,753,252 R56L possibly damaging Het
Hsd17b3 C T 13: 64,064,357 M168I probably damaging Het
Ighv1-34 G T 12: 114,851,265 D92E possibly damaging Het
Itgb4 A T 11: 115,994,345 I1018F possibly damaging Het
Itih3 T C 14: 30,915,648 D518G possibly damaging Het
Kcnma1 C T 14: 23,451,598 probably null Het
Klhl11 A T 11: 100,472,680 S17T probably benign Het
Lilra6 T C 7: 3,914,522 E158G possibly damaging Het
Loxl1 A G 9: 58,312,754 W45R probably damaging Het
Lrfn1 G T 7: 28,466,830 V550F probably damaging Het
Lrp1 T C 10: 127,573,499 K1584E probably benign Het
Lrp4 C G 2: 91,508,569 P1782A possibly damaging Het
Map3k1 A G 13: 111,748,944 S1480P probably damaging Het
Mark4 G T 7: 19,426,090 N748K probably benign Het
Mrpl38 G A 11: 116,135,074 T142M probably damaging Het
Mrpl41 T C 2: 24,974,469 T64A probably benign Het
Mrps2 G A 2: 28,469,752 R207K possibly damaging Het
Myo5a A T 9: 75,192,444 E96D Het
Nbas A T 12: 13,583,416 E2274V probably damaging Het
Olfr1022 T C 2: 85,868,934 L114P possibly damaging Het
Olfr1022 T A 2: 85,869,475 N294K probably damaging Het
Olfr1274-ps T C 2: 90,400,994 F111S probably damaging Het
Olfr570 T C 7: 102,900,445 I26T probably benign Het
Olfr616 T C 7: 103,564,643 D212G probably damaging Het
Olfr781 T A 10: 129,333,499 I206N possibly damaging Het
Pcdhga12 T A 18: 37,767,235 D373E probably damaging Het
Pgd A C 4: 149,151,139 F395V probably damaging Het
Pi16 A G 17: 29,319,389 M59V possibly damaging Het
Pik3r5 A T 11: 68,490,894 T255S probably benign Het
Plch2 A T 4: 154,984,059 V1370E probably benign Het
Plec A G 15: 76,182,953 I1309T unknown Het
Ppp2r3d A T 9: 124,440,831 S22R Het
Ptk2b C A 14: 66,175,705 E342* probably null Het
Ptpn23 T C 9: 110,386,158 probably null Het
Rfx8 A C 1: 39,683,690 S256A probably damaging Het
Rnf115 C T 3: 96,758,021 T69I probably damaging Het
Rnf213 A G 11: 119,479,631 Y4753C Het
S100a10 A C 3: 93,564,283 D58A possibly damaging Het
Serpina12 T C 12: 104,038,058 K105R probably benign Het
Slc20a2 G A 8: 22,538,884 G124S probably damaging Het
Stard9 C A 2: 120,696,154 T964N probably benign Het
Stxbp5 T A 10: 9,899,194 I72F probably damaging Het
Sumf2 T A 5: 129,862,641 M282K possibly damaging Het
Tmem135 G C 7: 89,147,978 L357V probably benign Het
Tmem185b G T 1: 119,526,883 V125L probably benign Het
Tmtc1 A G 6: 148,243,216 M887T probably damaging Het
Tnfaip8 C T 18: 50,090,445 Q83* probably null Het
Tnks A G 8: 34,838,935 V1162A probably damaging Het
Tomm70a T A 16: 57,140,709 Y342N possibly damaging Het
Tpo T A 12: 30,075,876 D828V probably damaging Het
Ugt8a A T 3: 125,914,689 N257K probably damaging Het
Uhrf1bp1l C A 10: 89,790,731 T429K probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 116,068,172 probably benign Het
Vim T A 2: 13,574,892 M154K probably damaging Het
Virma G T 4: 11,486,045 M1I probably null Het
Zfp715 A T 7: 43,301,229 M100K probably benign Het
Zfp748 A T 13: 67,542,528 C204* probably null Het
Zmynd8 A T 2: 165,838,852 D236E probably damaging Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86869206 splice site probably null
IGL00809:Stab2 APN 10 86848174 splice site probably benign
IGL00911:Stab2 APN 10 86969753 missense probably damaging 1.00
IGL01347:Stab2 APN 10 86901703 splice site probably null
IGL01411:Stab2 APN 10 86980008 splice site probably benign
IGL01503:Stab2 APN 10 86940613 splice site probably benign
IGL01599:Stab2 APN 10 86922895 missense probably damaging 1.00
IGL01635:Stab2 APN 10 86981128 missense probably benign 0.04
IGL01640:Stab2 APN 10 86954171 missense probably benign 0.09
IGL01671:Stab2 APN 10 86969277 missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86871831 missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86967650 missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86859742 splice site probably null
IGL02600:Stab2 APN 10 86954259 missense probably damaging 1.00
IGL02666:Stab2 APN 10 86850902 missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86846163 splice site probably benign
IGL02709:Stab2 APN 10 86846165 splice site probably benign
IGL02728:Stab2 APN 10 86856556 missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86950269 splice site probably benign
IGL02938:Stab2 APN 10 86871921 missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86996803 critical splice donor site probably null
IGL03238:Stab2 APN 10 86855121 missense probably damaging 1.00
IGL03402:Stab2 APN 10 86969301 missense probably benign 0.03
prospector UTSW 10 86901567 splice site probably null
songbird UTSW 10 86858152 missense probably damaging 1.00
3-1:Stab2 UTSW 10 86869177 missense probably damaging 0.96
F6893:Stab2 UTSW 10 86855171 missense probably damaging 1.00
K7371:Stab2 UTSW 10 86943289 critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86867175 missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86861435 nonsense probably null
R0015:Stab2 UTSW 10 86843617 missense probably benign
R0254:Stab2 UTSW 10 86897960 missense probably benign
R0310:Stab2 UTSW 10 86967613 splice site probably benign
R0333:Stab2 UTSW 10 86841627 missense probably benign
R0391:Stab2 UTSW 10 86947144 missense probably benign 0.27
R0400:Stab2 UTSW 10 86872610 missense probably damaging 1.00
R0433:Stab2 UTSW 10 86843491 splice site probably benign
R0440:Stab2 UTSW 10 86949928 missense probably benign 0.23
R0743:Stab2 UTSW 10 86887895 missense probably damaging 1.00
R0847:Stab2 UTSW 10 86969871 missense probably benign 0.00
R0883:Stab2 UTSW 10 86924450 splice site probably benign
R1078:Stab2 UTSW 10 86907133 splice site probably null
R1118:Stab2 UTSW 10 86885718 splice site probably null
R1119:Stab2 UTSW 10 86859755 missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86950301 missense probably damaging 0.98
R1440:Stab2 UTSW 10 86861367 splice site probably null
R1550:Stab2 UTSW 10 86878926 missense probably benign 0.01
R1616:Stab2 UTSW 10 86885718 splice site probably null
R1728:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1768:Stab2 UTSW 10 87003008 missense probably damaging 1.00
R1772:Stab2 UTSW 10 86954234 missense probably benign 0.06
R1776:Stab2 UTSW 10 86957816 missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1892:Stab2 UTSW 10 86938049 missense probably damaging 0.99
R1957:Stab2 UTSW 10 86861470 missense probably benign 0.13
R1972:Stab2 UTSW 10 86960316 missense probably damaging 0.99
R1975:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1976:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1996:Stab2 UTSW 10 87003031 missense probably damaging 1.00
R2085:Stab2 UTSW 10 86954159 missense probably damaging 1.00
R2149:Stab2 UTSW 10 86865040 nonsense probably null
R2169:Stab2 UTSW 10 86887862 missense probably damaging 1.00
R2201:Stab2 UTSW 10 86940639 missense probably benign 0.22
R2296:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86969319 missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86934840 splice site probably benign
R2696:Stab2 UTSW 10 86861499 missense probably benign 0.45
R2883:Stab2 UTSW 10 86967686 missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86861461 missense probably damaging 1.00
R3711:Stab2 UTSW 10 86866708 missense probably damaging 1.00
R3787:Stab2 UTSW 10 86969277 missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86949912 missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86878886 missense probably damaging 0.97
R3979:Stab2 UTSW 10 86863456 missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86858124 missense probably damaging 1.00
R4088:Stab2 UTSW 10 86922185 missense probably damaging 1.00
R4151:Stab2 UTSW 10 87002983 missense probably benign 0.12
R4190:Stab2 UTSW 10 86878944 missense probably damaging 0.98
R4556:Stab2 UTSW 10 86967679 missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86907371 nonsense probably null
R4825:Stab2 UTSW 10 86947147 missense probably benign 0.08
R4865:Stab2 UTSW 10 86843500 splice site probably null
R4871:Stab2 UTSW 10 86942235 missense probably damaging 0.99
R4943:Stab2 UTSW 10 86954162 missense probably damaging 0.99
R4981:Stab2 UTSW 10 86960223 missense probably benign
R4994:Stab2 UTSW 10 86949907 missense probably benign
R4999:Stab2 UTSW 10 86937909 missense probably damaging 0.97
R5061:Stab2 UTSW 10 86907385 missense probably damaging 1.00
R5072:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5073:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5074:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5134:Stab2 UTSW 10 86871810 splice site probably null
R5213:Stab2 UTSW 10 86907197 missense probably damaging 0.99
R5508:Stab2 UTSW 10 86960279 missense probably benign 0.01
R5530:Stab2 UTSW 10 86947162 missense probably benign 0.04
R5540:Stab2 UTSW 10 86848125 missense probably benign 0.30
R5839:Stab2 UTSW 10 86872691 missense probably damaging 0.97
R5949:Stab2 UTSW 10 86969849 missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86938042 missense probably damaging 0.99
R6019:Stab2 UTSW 10 87003022 missense probably benign 0.00
R6116:Stab2 UTSW 10 86907190 missense probably damaging 1.00
R6131:Stab2 UTSW 10 86883778 splice site probably null
R6209:Stab2 UTSW 10 86923003 missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86907161 missense probably damaging 1.00
R6433:Stab2 UTSW 10 86901567 splice site probably null
R6787:Stab2 UTSW 10 86919084 missense probably benign 0.07
R6841:Stab2 UTSW 10 86942190 missense probably damaging 1.00
R6873:Stab2 UTSW 10 86861366 critical splice donor site probably null
R7025:Stab2 UTSW 10 86850837 missense probably damaging 1.00
R7043:Stab2 UTSW 10 86870246 missense probably damaging 0.99
R7047:Stab2 UTSW 10 86858152 missense probably damaging 1.00
R7107:Stab2 UTSW 10 86905592 missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86899841 missense probably damaging 0.99
R7271:Stab2 UTSW 10 87003108 splice site probably null
R7291:Stab2 UTSW 10 86946220 missense probably damaging 0.96
R7336:Stab2 UTSW 10 86969185 nonsense probably null
R7432:Stab2 UTSW 10 86885683 missense probably damaging 0.99
R7580:Stab2 UTSW 10 86869164 missense probably benign 0.00
R7622:Stab2 UTSW 10 86873902 missense possibly damaging 0.65
R7629:Stab2 UTSW 10 86883782 critical splice donor site probably null
R7658:Stab2 UTSW 10 86981135 missense probably benign 0.12
R7798:Stab2 UTSW 10 86957912 missense probably damaging 0.98
R7835:Stab2 UTSW 10 86872619 missense probably benign 0.06
R7845:Stab2 UTSW 10 86996894 missense probably benign 0.09
R7863:Stab2 UTSW 10 86972881 missense probably benign 0.30
R7885:Stab2 UTSW 10 86878912 missense probably benign 0.03
R7904:Stab2 UTSW 10 86954192 nonsense probably null
R7947:Stab2 UTSW 10 86846033 missense probably benign 0.31
R7963:Stab2 UTSW 10 86848023 critical splice donor site probably null
R8014:Stab2 UTSW 10 86850903 missense possibly damaging 0.78
R8021:Stab2 UTSW 10 86905539 missense possibly damaging 0.69
R8024:Stab2 UTSW 10 86846052 missense probably benign 0.34
R8097:Stab2 UTSW 10 86869095 missense possibly damaging 0.86
R8281:Stab2 UTSW 10 86873864 missense probably damaging 0.98
R8462:Stab2 UTSW 10 86967734 missense possibly damaging 0.79
R8670:Stab2 UTSW 10 86940723 missense probably damaging 1.00
R8692:Stab2 UTSW 10 86972930 missense probably damaging 0.99
R8744:Stab2 UTSW 10 86969349 missense probably benign 0.32
R8745:Stab2 UTSW 10 86969349 missense probably benign 0.32
R8782:Stab2 UTSW 10 86899821 missense probably benign 0.00
R8875:Stab2 UTSW 10 86996864 missense probably damaging 1.00
R8978:Stab2 UTSW 10 86949918 missense possibly damaging 0.64
R9141:Stab2 UTSW 10 86869047 missense probably damaging 1.00
R9248:Stab2 UTSW 10 86891617 missense probably damaging 0.98
R9326:Stab2 UTSW 10 86955146 missense probably damaging 1.00
R9426:Stab2 UTSW 10 86869047 missense probably damaging 1.00
R9568:Stab2 UTSW 10 86863556 missense probably damaging 1.00
R9627:Stab2 UTSW 10 86957840 missense probably damaging 0.98
R9635:Stab2 UTSW 10 86850787 nonsense probably null
R9648:Stab2 UTSW 10 86856697 frame shift probably null
R9650:Stab2 UTSW 10 86856697 frame shift probably null
R9726:Stab2 UTSW 10 86954231 missense probably benign 0.00
R9756:Stab2 UTSW 10 86967689 missense possibly damaging 0.50
R9786:Stab2 UTSW 10 86922133 missense probably benign 0.03
RF061:Stab2 UTSW 10 86866758 critical splice acceptor site probably benign
X0023:Stab2 UTSW 10 86922198 critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86887816 missense probably damaging 1.00
Z1176:Stab2 UTSW 10 86949914 missense probably damaging 0.99
Z1177:Stab2 UTSW 10 86896596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGACACTAGGCCTAACATG -3'
(R):5'- TACAAGCTAGTAGAGAGCCAAC -3'

Sequencing Primer
(F):5'- GCTGCTATACTAAATGTCCCCAGGG -3'
(R):5'- CTAGTAGAGAGCCAACAGATCATG -3'
Posted On 2022-10-06