Mutagenetix > Incidental Mutation

Incidental Mutation 'R9651:Muc2'

727104

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R9651 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 141701445 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 262 (P262S)

Ref Sequence

ENSEMBL: ENSMUSP00000140855 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000167366

SMART Domains

Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	72	2.3e-14	PFAM
C8	107	181	1.82e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179227

SMART Domains

Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
C8	11	85	1.61e-32	SMART
Blast:VWD	102	128	5e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000185406

SMART Domains

Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
VWD	20	183	1.5e-40	SMART
C8	216	290	3.9e-15	SMART
Pfam:TIL	293	349	5.4e-10	PFAM
VWC	351	411	7e-4	SMART
VWD	378	542	8.8e-44	SMART
C8	579	653	1.2e-36	SMART
SCOP:d1coua_	654	728	4e-8	SMART
VWC_def	820	865	1.3e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000185823
AA Change: P262S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515
AA Change: P262S

Domain	Start	End	E-Value	Type
Pfam:VWD	3	73	5.6e-14	PFAM
C8	108	182	1.4e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187789

Predicted Effect

probably benign
Transcript: ENSMUST00000191587

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405L10Rik	T	C	8: 105,709,972	S267P		Het
Abca13	C	T	11: 9,293,741	P1868L	probably benign	Het
Abca13	A	G	11: 9,585,484	S4703G	probably benign	Het
Abca9	A	T	11: 110,115,493	M1262K	probably benign	Het
Acta1	A	T	8: 123,892,692	Y220*	probably null	Het
Actr6	A	G	10: 89,729,015	V24A	probably damaging	Het
Adam30	T	C	3: 98,162,620	Y590H	possibly damaging	Het
Akap8l	T	C	17: 32,338,809	N35D	probably damaging	Het
Ankle2	A	G	5: 110,237,795	I337V	probably benign	Het
Arid2	T	C	15: 96,358,941	V220A	probably benign	Het
Atp8b2	T	C	3: 89,958,296	D99G	probably damaging	Het
Baz1b	A	T	5: 135,223,168	H940L	probably benign	Het
Cacna1d	C	T	14: 30,042,924	V2017I	probably benign	Het
Cd226	T	A	18: 89,247,271	C224*	probably null	Het
Cdrt4	T	A	11: 62,992,640	I56N	possibly damaging	Het
Ces3b	G	T	8: 105,085,625	A169S	probably damaging	Het
Cramp1l	C	A	17: 24,982,809	K566N	probably damaging	Het
Cryz	A	G	3: 154,622,128	Q289R	probably benign	Het
Csn1s2b	T	A	5: 87,820,961	M94K	probably benign	Het
Ctnnd1	T	C	2: 84,609,555	K804E	possibly damaging	Het
Cwh43	T	C	5: 73,414,997	S193P	probably benign	Het
Cyr61	G	T	3: 145,648,828	N109K	probably damaging	Het
Dcstamp	A	T	15: 39,760,396	D469V	probably benign	Het
Dffa	A	G	4: 149,106,217	T68A	probably damaging	Het
Dnah2	C	T	11: 69,450,998		probably null	Het
Dst	T	A	1: 34,180,377	I1966N	probably benign	Het
Efcab5	G	A	11: 77,132,108	T593I	probably damaging	Het
Epn3	C	T	11: 94,492,861		probably null	Het
Fem1c	A	T	18: 46,524,607	D13E		Het
Foxo3	C	T	10: 42,197,025	V499M	probably damaging	Het
Fpr2	T	A	17: 17,893,222	I160N	probably benign	Het
Gabra1	A	G	11: 42,155,026	Y86H	probably damaging	Het
Gabrb3	T	C	7: 57,765,454	Y91H	probably damaging	Het
Gcn1l1	T	C	5: 115,609,606		probably null	Het
Gp5	A	C	16: 30,309,575	F94V	probably damaging	Het
Gpr152	T	G	19: 4,142,615	W52G	probably damaging	Het
Hsd17b12	A	G	2: 94,157,736	V45A	probably benign	Het
Htr5a	A	G	5: 27,842,840	N131S	possibly damaging	Het
Il16	T	A	7: 83,682,856	N172I	probably damaging	Het
Itga2	G	A	13: 114,884,455	P120L	probably benign	Het
Itpkb	G	T	1: 180,332,491	E61*	probably null	Het
Lama1	T	C	17: 67,794,220	S1903P		Het
Llgl2	A	T	11: 115,852,115		probably null	Het
Mical1	A	T	10: 41,486,026		probably null	Het
Myo9a	A	G	9: 59,871,481	R1507G	probably damaging	Het
Ndst1	G	A	18: 60,700,467	H491Y	probably damaging	Het
Nfasc	T	C	1: 132,600,053	T872A	probably benign	Het
Nipal3	A	T	4: 135,447,323	C372*	probably null	Het
Nmrk1	A	G	19: 18,639,565	H26R	probably benign	Het
Nubp2	G	A	17: 24,884,408	T165I	probably damaging	Het
Olfr1454	T	G	19: 13,063,892	D160E	probably benign	Het
Olfr164	C	T	16: 19,286,739	M1I	probably null	Het
Olfr221	T	C	14: 52,035,748	D121G	probably damaging	Het
Olfr557	T	A	7: 102,698,625	M129K	probably damaging	Het
P2ry12	T	C	3: 59,227,510		probably benign	Het
Pax8	T	A	2: 24,441,161	D174V	probably damaging	Het
Pbxip1	A	G	3: 89,445,488	D147G	probably damaging	Het
Pnpla7	T	C	2: 25,002,919	S451P	probably benign	Het
Polm	A	G	11: 5,831,732	Y255H	probably damaging	Het
Rdh14	T	A	12: 10,391,118	C93*	probably null	Het
Rnf213	C	A	11: 119,440,412	S2150Y		Het
Rpap1	G	A	2: 119,768,003	P1111L	probably damaging	Het
Rpl3l	T	A	17: 24,728,354	L14Q	probably damaging	Het
Sbp	A	G	17: 23,945,445	*200W	probably null	Het
Scn10a	A	G	9: 119,609,997	M1601T	probably benign	Het
Sertad4	C	T	1: 192,846,528	D327N	probably damaging	Het
Slc4a1	A	T	11: 102,351,430	I821N	probably damaging	Het
Spaca6	T	A	17: 17,837,567	D164E	probably benign	Het
Synj1	T	C	16: 90,938,524	T1514A	probably benign	Het
Synj1	C	T	16: 90,960,455	V902I	possibly damaging	Het
Tctn1	A	G	5: 122,246,513	Y443H	probably benign	Het
Thoc5	C	T	11: 4,899,883	R25W	possibly damaging	Het
Tmem200c	A	G	17: 68,842,186	H588R	probably benign	Het
Trim45	C	T	3: 100,925,389	Q313*	probably null	Het
Ubqlnl	T	C	7: 104,149,915	D125G	possibly damaging	Het
Ubr4	A	T	4: 139,479,548	E4926V	unknown	Het
Usp5	T	C	6: 124,822,538	D349G	possibly damaging	Het
Vmn1r25	T	A	6: 57,979,321		probably benign	Het
Xirp2	A	G	2: 67,513,823	Q2136R	possibly damaging	Het
Zfp28	G	A	7: 6,392,624	R134H		Het
Zfp712	A	G	13: 67,040,760	S568P	probably benign	Het
Znrd1as	C	T	17: 36,965,461	Q242*	probably null	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- TGTCTTCATAGATGGGCATCCC -3'
(R):5'- GACCCATGTGTGTTGCTTGC -3'

Sequencing Primer
(F):5'- CCCAAGCAAAAGACCAGGTGG -3'
(R):5'- GTGACCTCATTTCCATGTGTATGAAC -3'

Posted On

2022-10-06