Incidental Mutation 'R9651:Muc2'
ID 727104
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Name mucin 2
Synonyms 2010015E03Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R9651 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 141276583-141308428 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 141288014 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 262 (P262S)
Ref Sequence ENSEMBL: ENSMUSP00000140855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000167366
SMART Domains Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
Pfam:VWD 3 72 2.3e-14 PFAM
C8 107 181 1.82e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179227
SMART Domains Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
C8 11 85 1.61e-32 SMART
Blast:VWD 102 128 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185406
SMART Domains Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
VWD 20 183 1.5e-40 SMART
C8 216 290 3.9e-15 SMART
Pfam:TIL 293 349 5.4e-10 PFAM
VWC 351 411 7e-4 SMART
VWD 378 542 8.8e-44 SMART
C8 579 653 1.2e-36 SMART
SCOP:d1coua_ 654 728 4e-8 SMART
VWC_def 820 865 1.3e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185823
AA Change: P262S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515
AA Change: P262S

DomainStartEndE-ValueType
Pfam:VWD 3 73 5.6e-14 PFAM
C8 108 182 1.4e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187789
Predicted Effect probably benign
Transcript: ENSMUST00000191587
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik T C 8: 106,436,604 (GRCm39) S267P Het
Abca13 C T 11: 9,243,741 (GRCm39) P1868L probably benign Het
Abca13 A G 11: 9,535,484 (GRCm39) S4703G probably benign Het
Abca9 A T 11: 110,006,319 (GRCm39) M1262K probably benign Het
Acta1 A T 8: 124,619,431 (GRCm39) Y220* probably null Het
Actr6 A G 10: 89,564,877 (GRCm39) V24A probably damaging Het
Adam30 T C 3: 98,069,936 (GRCm39) Y590H possibly damaging Het
Akap8l T C 17: 32,557,783 (GRCm39) N35D probably damaging Het
Ankle2 A G 5: 110,385,661 (GRCm39) I337V probably benign Het
Arid2 T C 15: 96,256,822 (GRCm39) V220A probably benign Het
Atp8b2 T C 3: 89,865,603 (GRCm39) D99G probably damaging Het
Baz1b A T 5: 135,252,022 (GRCm39) H940L probably benign Het
Cacna1d C T 14: 29,764,881 (GRCm39) V2017I probably benign Het
Ccn1 G T 3: 145,354,583 (GRCm39) N109K probably damaging Het
Cd226 T A 18: 89,265,395 (GRCm39) C224* probably null Het
Cdrt4 T A 11: 62,883,466 (GRCm39) I56N possibly damaging Het
Ces3b G T 8: 105,812,257 (GRCm39) A169S probably damaging Het
Cramp1 C A 17: 25,201,783 (GRCm39) K566N probably damaging Het
Cryz A G 3: 154,327,765 (GRCm39) Q289R probably benign Het
Csn1s2b T A 5: 87,968,820 (GRCm39) M94K probably benign Het
Ctnnd1 T C 2: 84,439,899 (GRCm39) K804E possibly damaging Het
Cwh43 T C 5: 73,572,340 (GRCm39) S193P probably benign Het
Dcstamp A T 15: 39,623,792 (GRCm39) D469V probably benign Het
Dffa A G 4: 149,190,674 (GRCm39) T68A probably damaging Het
Dnah2 C T 11: 69,341,824 (GRCm39) probably null Het
Dst T A 1: 34,219,458 (GRCm39) I1966N probably benign Het
Efcab5 G A 11: 77,022,934 (GRCm39) T593I probably damaging Het
Epn3 C T 11: 94,383,687 (GRCm39) probably null Het
Fem1c A T 18: 46,657,674 (GRCm39) D13E Het
Foxo3 C T 10: 42,073,021 (GRCm39) V499M probably damaging Het
Fpr2 T A 17: 18,113,484 (GRCm39) I160N probably benign Het
Gabra1 A G 11: 42,045,853 (GRCm39) Y86H probably damaging Het
Gabrb3 T C 7: 57,415,202 (GRCm39) Y91H probably damaging Het
Gcn1 T C 5: 115,747,665 (GRCm39) probably null Het
Gp5 A C 16: 30,128,393 (GRCm39) F94V probably damaging Het
Gpr152 T G 19: 4,192,614 (GRCm39) W52G probably damaging Het
Hsd17b12 A G 2: 93,988,081 (GRCm39) V45A probably benign Het
Htr5a A G 5: 28,047,838 (GRCm39) N131S possibly damaging Het
Il16 T A 7: 83,332,064 (GRCm39) N172I probably damaging Het
Itga2 G A 13: 115,020,991 (GRCm39) P120L probably benign Het
Itpkb G T 1: 180,160,056 (GRCm39) E61* probably null Het
Lama1 T C 17: 68,101,215 (GRCm39) S1903P Het
Llgl2 A T 11: 115,742,941 (GRCm39) probably null Het
Mical1 A T 10: 41,362,022 (GRCm39) probably null Het
Myo9a A G 9: 59,778,764 (GRCm39) R1507G probably damaging Het
Ndst1 G A 18: 60,833,539 (GRCm39) H491Y probably damaging Het
Nfasc T C 1: 132,527,791 (GRCm39) T872A probably benign Het
Nipal3 A T 4: 135,174,634 (GRCm39) C372* probably null Het
Nmrk1 A G 19: 18,616,929 (GRCm39) H26R probably benign Het
Nubp2 G A 17: 25,103,382 (GRCm39) T165I probably damaging Het
Or2m12 C T 16: 19,105,489 (GRCm39) M1I probably null Het
Or51d1 T A 7: 102,347,832 (GRCm39) M129K probably damaging Het
Or5au1 T C 14: 52,273,205 (GRCm39) D121G probably damaging Het
Or5b102 T G 19: 13,041,256 (GRCm39) D160E probably benign Het
P2ry12 T C 3: 59,134,931 (GRCm39) probably benign Het
Pax8 T A 2: 24,331,173 (GRCm39) D174V probably damaging Het
Pbxip1 A G 3: 89,352,795 (GRCm39) D147G probably damaging Het
Pnpla7 T C 2: 24,892,931 (GRCm39) S451P probably benign Het
Polm A G 11: 5,781,732 (GRCm39) Y255H probably damaging Het
Polr1has C T 17: 37,276,353 (GRCm39) Q242* probably null Het
Rdh14 T A 12: 10,441,118 (GRCm39) C93* probably null Het
Rnf213 C A 11: 119,331,238 (GRCm39) S2150Y Het
Rpap1 G A 2: 119,598,484 (GRCm39) P1111L probably damaging Het
Rpl3l T A 17: 24,947,328 (GRCm39) L14Q probably damaging Het
Sbp A G 17: 24,164,419 (GRCm39) *200W probably null Het
Scn10a A G 9: 119,439,063 (GRCm39) M1601T probably benign Het
Sertad4 C T 1: 192,528,836 (GRCm39) D327N probably damaging Het
Slc4a1 A T 11: 102,242,256 (GRCm39) I821N probably damaging Het
Spaca6 T A 17: 18,057,829 (GRCm39) D164E probably benign Het
Synj1 T C 16: 90,735,412 (GRCm39) T1514A probably benign Het
Synj1 C T 16: 90,757,343 (GRCm39) V902I possibly damaging Het
Tctn1 A G 5: 122,384,576 (GRCm39) Y443H probably benign Het
Thoc5 C T 11: 4,849,883 (GRCm39) R25W possibly damaging Het
Tmem200c A G 17: 69,149,181 (GRCm39) H588R probably benign Het
Trim45 C T 3: 100,832,705 (GRCm39) Q313* probably null Het
Ubqlnl T C 7: 103,799,122 (GRCm39) D125G possibly damaging Het
Ubr4 A T 4: 139,206,859 (GRCm39) E4926V unknown Het
Usp5 T C 6: 124,799,501 (GRCm39) D349G possibly damaging Het
Vmn1r25 T A 6: 57,956,306 (GRCm39) probably benign Het
Xirp2 A G 2: 67,344,167 (GRCm39) Q2136R possibly damaging Het
Zfp28 G A 7: 6,395,623 (GRCm39) R134H Het
Zfp712 A G 13: 67,188,824 (GRCm39) S568P probably benign Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141,693,356 (GRCm38) missense probably benign 0.35
kenny APN 7 0 () nonsense
Winnie APN 7 141,286,029 (GRCm39) missense probably damaging 1.00
IGL01303:Muc2 APN 7 141,306,132 (GRCm39) missense probably benign
IGL01482:Muc2 APN 7 141,307,797 (GRCm39) missense probably damaging 0.96
IGL01875:Muc2 APN 7 141,306,477 (GRCm39) missense probably damaging 0.99
IGL02088:Muc2 APN 7 141,305,241 (GRCm39) missense probably damaging 1.00
IGL02415:Muc2 APN 7 141,305,609 (GRCm39) nonsense probably null
IGL02548:Muc2 APN 7 141,305,594 (GRCm39) missense probably damaging 1.00
IGL02836:Muc2 APN 7 141,300,450 (GRCm39) unclassified probably benign
IGL03196:Muc2 APN 7 141,301,367 (GRCm39) missense probably damaging 0.97
Muskatenwein UTSW 7 141,307,176 (GRCm39) missense unknown
nomoco UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
Schlendrian UTSW 7 141,281,925 (GRCm39) missense probably damaging 1.00
Seco UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
BB001:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
BB011:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
E0370:Muc2 UTSW 7 141,282,598 (GRCm39) missense probably damaging 1.00
R0127:Muc2 UTSW 7 141,302,691 (GRCm39) missense probably benign 0.00
R0179:Muc2 UTSW 7 141,302,708 (GRCm39) missense probably damaging 1.00
R0201:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0299:Muc2 UTSW 7 141,306,466 (GRCm39) missense probably damaging 1.00
R0547:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0699:Muc2 UTSW 7 141,306,037 (GRCm39) missense probably damaging 1.00
R0900:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1348:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1625:Muc2 UTSW 7 141,283,405 (GRCm39) missense probably damaging 1.00
R2010:Muc2 UTSW 7 141,287,444 (GRCm39) missense probably damaging 0.99
R2149:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R2163:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R3008:Muc2 UTSW 7 141,281,347 (GRCm39) missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3112:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3424:Muc2 UTSW 7 141,279,595 (GRCm39) missense probably damaging 0.99
R3786:Muc2 UTSW 7 141,283,590 (GRCm39) missense probably benign 0.01
R3854:Muc2 UTSW 7 141,308,081 (GRCm39) missense probably damaging 1.00
R3964:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3965:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3966:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3973:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3974:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3976:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R4327:Muc2 UTSW 7 141,281,577 (GRCm39) missense probably damaging 0.96
R4694:Muc2 UTSW 7 141,306,082 (GRCm39) missense probably damaging 1.00
R4764:Muc2 UTSW 7 141,299,345 (GRCm39) missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141,286,260 (GRCm39) critical splice donor site probably null
R4798:Muc2 UTSW 7 141,307,877 (GRCm39) missense probably benign 0.01
R4900:Muc2 UTSW 7 141,303,280 (GRCm39) missense probably benign 0.32
R5383:Muc2 UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
R5489:Muc2 UTSW 7 141,305,169 (GRCm39) missense probably benign 0.00
R5615:Muc2 UTSW 7 141,277,446 (GRCm39) missense probably damaging 1.00
R5856:Muc2 UTSW 7 141,299,381 (GRCm39) unclassified probably benign
R5919:Muc2 UTSW 7 141,281,171 (GRCm39) missense probably damaging 0.97
R5953:Muc2 UTSW 7 141,287,951 (GRCm39) missense probably damaging 0.96
R5979:Muc2 UTSW 7 141,305,143 (GRCm39) missense probably damaging 0.99
R5979:Muc2 UTSW 7 141,283,493 (GRCm39) splice site probably null
R6175:Muc2 UTSW 7 141,282,875 (GRCm39) missense probably damaging 1.00
R6213:Muc2 UTSW 7 141,305,151 (GRCm39) missense probably damaging 1.00
R6281:Muc2 UTSW 7 141,306,140 (GRCm39) missense probably damaging 1.00
R6321:Muc2 UTSW 7 141,287,397 (GRCm39) missense probably benign 0.28
R6390:Muc2 UTSW 7 141,305,883 (GRCm39) missense probably damaging 0.97
R6485:Muc2 UTSW 7 141,300,473 (GRCm39) unclassified probably benign
R6582:Muc2 UTSW 7 141,282,941 (GRCm39) missense probably benign 0.00
R6683:Muc2 UTSW 7 141,305,214 (GRCm39) missense probably benign 0.38
R6896:Muc2 UTSW 7 141,306,432 (GRCm39) missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
R6924:Muc2 UTSW 7 141,284,077 (GRCm39) missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141,305,194 (GRCm39) missense unknown
R7222:Muc2 UTSW 7 141,290,758 (GRCm39) missense
R7251:Muc2 UTSW 7 141,278,965 (GRCm39) missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141,306,481 (GRCm39) missense
R7315:Muc2 UTSW 7 141,276,645 (GRCm39) missense probably damaging 0.99
R7421:Muc2 UTSW 7 141,301,863 (GRCm39) missense
R7556:Muc2 UTSW 7 141,307,439 (GRCm39) missense
R7651:Muc2 UTSW 7 141,290,750 (GRCm39) missense
R7710:Muc2 UTSW 7 141,287,452 (GRCm39) missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141,290,942 (GRCm39) missense
R7813:Muc2 UTSW 7 141,282,543 (GRCm39) splice site probably null
R7843:Muc2 UTSW 7 141,281,662 (GRCm39) missense probably benign 0.03
R7869:Muc2 UTSW 7 141,303,471 (GRCm39) missense
R7924:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
R7993:Muc2 UTSW 7 141,308,173 (GRCm39) missense
R8053:Muc2 UTSW 7 141,284,575 (GRCm39) missense probably benign 0.01
R8068:Muc2 UTSW 7 141,298,422 (GRCm39) missense
R8099:Muc2 UTSW 7 141,299,175 (GRCm39) splice site probably null
R8192:Muc2 UTSW 7 141,305,215 (GRCm39) missense
R8194:Muc2 UTSW 7 141,290,801 (GRCm39) missense
R8545:Muc2 UTSW 7 141,306,130 (GRCm39) missense unknown
R8701:Muc2 UTSW 7 141,281,850 (GRCm39) missense probably damaging 1.00
R8883:Muc2 UTSW 7 141,287,469 (GRCm39) missense probably damaging 0.98
R8894:Muc2 UTSW 7 141,280,758 (GRCm39) missense probably damaging 1.00
R8905:Muc2 UTSW 7 141,279,643 (GRCm39) missense probably benign 0.00
R9024:Muc2 UTSW 7 141,287,936 (GRCm39) missense probably damaging 0.98
R9032:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9085:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9091:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9104:Muc2 UTSW 7 141,286,224 (GRCm39) missense probably damaging 1.00
R9114:Muc2 UTSW 7 141,287,983 (GRCm39) nonsense probably null
R9270:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9297:Muc2 UTSW 7 141,302,759 (GRCm39) missense
R9325:Muc2 UTSW 7 141,298,559 (GRCm39) missense
R9354:Muc2 UTSW 7 141,307,157 (GRCm39) missense
R9386:Muc2 UTSW 7 141,279,389 (GRCm39) missense probably damaging 1.00
R9529:Muc2 UTSW 7 141,287,453 (GRCm39) missense possibly damaging 0.55
R9550:Muc2 UTSW 7 141,308,242 (GRCm39) missense probably damaging 1.00
R9583:Muc2 UTSW 7 141,300,559 (GRCm39) missense
R9607:Muc2 UTSW 7 141,305,190 (GRCm39) missense
R9646:Muc2 UTSW 7 141,276,643 (GRCm39) missense probably benign
R9774:Muc2 UTSW 7 141,285,811 (GRCm39) missense probably benign
R9784:Muc2 UTSW 7 141,280,785 (GRCm39) nonsense probably null
Z1176:Muc2 UTSW 7 141,300,451 (GRCm39) missense
Z1177:Muc2 UTSW 7 141,298,531 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGTCTTCATAGATGGGCATCCC -3'
(R):5'- GACCCATGTGTGTTGCTTGC -3'

Sequencing Primer
(F):5'- CCCAAGCAAAAGACCAGGTGG -3'
(R):5'- GTGACCTCATTTCCATGTGTATGAAC -3'
Posted On 2022-10-06