Mutagenetix > Incidental Mutation

Incidental Mutation 'R9653:Usp24'

727170

Institutional Source

Beutler Lab

Gene Symbol

Usp24

Ensembl Gene

ENSMUSG00000028514

Gene Name

ubiquitin specific peptidase 24

Synonyms

2810030C21Rik, 2700066K03Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9653 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

106316213-106441322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 106347367 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 261 (M261K)

Ref Sequence

ENSEMBL: ENSMUSP00000133095 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]

AlphaFold

B1AY13

Predicted Effect

probably benign
Transcript: ENSMUST00000094933
AA Change: M261K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: M261K

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	882	6e-7	SMART
low complexity region	1031	1059	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1365	1378	N/A	INTRINSIC
Pfam:UCH	1685	2036	3.7e-54	PFAM
Pfam:UCH_1	1686	1993	1.8e-27	PFAM
low complexity region	2066	2081	N/A	INTRINSIC
low complexity region	2256	2267	N/A	INTRINSIC
low complexity region	2576	2592	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165709
AA Change: M261K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: M261K

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	883	8e-7	SMART
low complexity region	1032	1060	N/A	INTRINSIC
low complexity region	1125	1151	N/A	INTRINSIC
low complexity region	1366	1379	N/A	INTRINSIC
Pfam:UCH	1686	2037	2e-49	PFAM
Pfam:UCH_1	1687	1994	4e-24	PFAM
low complexity region	2067	2082	N/A	INTRINSIC
low complexity region	2257	2268	N/A	INTRINSIC
low complexity region	2577	2593	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	C	T	11: 9,293,741	P1868L	probably benign	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Adamtsl5	C	T	10: 80,344,929	G100R	probably damaging	Het
Adgrg5	C	T	8: 94,937,236	P235S		Het
Anks1b	T	G	10: 90,510,662	L608R	probably damaging	Het
Ano10	C	G	9: 122,251,155	A597P	possibly damaging	Het
Calb2	T	C	8: 110,154,742	M58V	probably benign	Het
Ccdc180	T	C	4: 45,923,495	I1092T	probably damaging	Het
Ces3b	G	T	8: 105,085,625	A169S	probably damaging	Het
Chmp2a	A	T	7: 13,032,529	F129I	probably damaging	Het
Clasp2	T	A	9: 113,841,925	W365R	probably benign	Het
Col12a1	T	C	9: 79,677,274	K1344R	probably benign	Het
Col3a1	A	G	1: 45,321,568	I53V	unknown	Het
Coro2b	T	C	9: 62,427,977	Y309C	probably damaging	Het
Cramp1l	C	A	17: 24,982,809	K566N	probably damaging	Het
Crygs	T	A	16: 22,806,554	T46S	probably benign	Het
Ctbp2	C	G	7: 133,014,204	R334P	probably damaging	Het
Dcstamp	A	T	15: 39,760,396	D469V	probably benign	Het
Dhdh	T	C	7: 45,479,127	D209G	probably damaging	Het
Dnah7b	T	C	1: 46,213,384	V1742A	possibly damaging	Het
Dnaja2	T	C	8: 85,539,353	T368A	probably benign	Het
Dscaml1	T	C	9: 45,732,168		probably null	Het
Eps8l1	A	T	7: 4,478,887	K704M	unknown	Het
Fam159b	A	G	13: 104,863,788		probably benign	Het
Fam186b	G	A	15: 99,279,735	A570V	probably damaging	Het
Fgd4	T	A	16: 16,436,597	H524L	probably benign	Het
Fktn	T	A	4: 53,731,273	F103I	probably benign	Het
Gcc2	T	C	10: 58,275,000	M1001T	possibly damaging	Het
Gm4847	T	C	1: 166,640,013	S205G	possibly damaging	Het
Grid2	A	T	6: 63,930,984	N203Y	possibly damaging	Het
Hif3a	G	A	7: 17,048,716	A308V	probably damaging	Het
Htr5a	A	G	5: 27,842,840	N131S	possibly damaging	Het
Igfn1	G	A	1: 135,955,585	Q2728*	probably null	Het
Ighv5-16	C	A	12: 113,838,693	K62N	possibly damaging	Het
Ip6k3	A	T	17: 27,148,614	Y203N	possibly damaging	Het
Itga2	G	A	13: 114,884,455	P120L	probably benign	Het
Itpkb	G	T	1: 180,332,491	E61*	probably null	Het
Kcnj3	G	A	2: 55,594,852	V321M	probably damaging	Het
Kmt2c	A	G	5: 25,302,821	L3206P	probably damaging	Het
Krtap5-4	T	C	7: 142,304,171	C193R	unknown	Het
Large1	G	T	8: 72,837,478	H553Q	probably benign	Het
Lrfn5	T	A	12: 61,843,632	V569D	probably damaging	Het
Luzp2	A	G	7: 55,052,832	T48A	probably damaging	Het
Lypd6	A	T	2: 50,190,746	T149S	probably benign	Het
Map3k1	T	C	13: 111,753,762	N1301S	possibly damaging	Het
Ndufv2	C	T	17: 66,089,256	W91*	probably null	Het
Nisch	A	T	14: 31,171,671	V1315E	probably damaging	Het
Npas1	T	C	7: 16,456,221	I467V	probably benign	Het
Nucb1	A	G	7: 45,494,778	M337T	probably benign	Het
Olfr1315-ps1	A	T	2: 112,110,916	M112K	probably damaging	Het
Olfr610	C	T	7: 103,506,520	R142H	probably benign	Het
Olfr682-ps1	A	T	7: 105,126,778	N164K	probably benign	Het
Olfr960	T	C	9: 39,623,858	L243P	probably damaging	Het
Oog3	T	G	4: 144,157,919	R482S	probably benign	Het
Padi2	T	C	4: 140,934,725		probably null	Het
Pam	C	T	1: 97,840,744	V660M	possibly damaging	Het
Phc2	C	T	4: 128,747,219	L700F	probably damaging	Het
Plekha1	T	C	7: 130,877,764	V4A	possibly damaging	Het
Rai1	A	G	11: 60,189,316	E1402G	probably benign	Het
Recql5	G	A	11: 115,897,206	A429V	probably benign	Het
Rere	A	G	4: 150,431,553	N101S	probably benign	Het
Robo1	T	G	16: 73,024,442	S1357A	possibly damaging	Het
Rsl1	T	A	13: 67,182,042	Y185N	probably damaging	Het
Rsph3a	T	C	17: 7,946,242	S145P	possibly damaging	Het
Sall1	T	C	8: 89,030,878	E866G	probably damaging	Het
Sall3	A	T	18: 80,973,013	S567T	probably benign	Het
Sap30	G	A	8: 57,485,122	Q154*	probably null	Het
Sbf2	T	C	7: 110,441,495	Q375R	possibly damaging	Het
Scn8a	A	G	15: 101,040,066	E1772G	probably damaging	Het
Scube3	C	T	17: 28,156,798	A169V	probably damaging	Het
Sema6c	T	C	3: 95,173,214	S940P	probably benign	Het
Sertad4	C	T	1: 192,846,528	D327N	probably damaging	Het
Skp1a	A	G	11: 52,243,687	T82A	possibly damaging	Het
Slc39a14	G	T	14: 70,309,799	T366K	probably damaging	Het
Snrnp200	G	T	2: 127,226,039	V819L	probably damaging	Het
Sntg1	T	A	1: 8,363,525	T501S	unknown	Het
Srsf12	T	C	4: 33,231,249	S253P	possibly damaging	Het
Sycp2l	A	G	13: 41,141,905	S315G	probably benign	Het
Tars2	T	C	3: 95,748,067	Y337C	probably damaging	Het
Thbs4	T	C	13: 92,761,514	D599G	probably benign	Het
Tmem200c	A	G	17: 68,842,186	H588R	probably benign	Het
Tmem255b	T	A	8: 13,456,005	V204E	probably damaging	Het
Utrn	T	A	10: 12,621,379	I2429F	probably benign	Het
Utrn	C	T	10: 12,663,445	A1943T	probably benign	Het
Vmn2r85	A	T	10: 130,425,825	D214E	probably damaging	Het
Wdr81	G	T	11: 75,449,387	P183T		Het
Zfp28	G	A	7: 6,392,624	R134H		Het
Zfp532	T	A	18: 65,623,237	D80E	possibly damaging	Het
Zfyve26	T	C	12: 79,287,644	D200G	probably benign	Het

Other mutations in Usp24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Usp24	APN	4	106359091	missense	probably benign
IGL00340:Usp24	APN	4	106401139	missense	probably damaging	0.99
IGL00480:Usp24	APN	4	106368106	missense	probably damaging	0.99
IGL00548:Usp24	APN	4	106341298	missense	probably damaging	0.96
IGL00655:Usp24	APN	4	106390318	missense	probably damaging	0.99
IGL00674:Usp24	APN	4	106372679	splice site	probably benign
IGL00718:Usp24	APN	4	106409704	missense	probably benign	0.10
IGL00803:Usp24	APN	4	106385526	splice site	probably benign
IGL01161:Usp24	APN	4	106436844	missense	probably benign	0.02
IGL01344:Usp24	APN	4	106379385	missense	possibly damaging	0.73
IGL01374:Usp24	APN	4	106380099	missense	possibly damaging	0.86
IGL01485:Usp24	APN	4	106362232	missense	probably benign	0.01
IGL01736:Usp24	APN	4	106423461	missense	probably benign	0.00
IGL01737:Usp24	APN	4	106387734	missense	probably benign	0.03
IGL01862:Usp24	APN	4	106408898	splice site	probably benign
IGL01981:Usp24	APN	4	106375768	splice site	probably benign
IGL02090:Usp24	APN	4	106411426	missense	possibly damaging	0.55
IGL02275:Usp24	APN	4	106387493	missense	probably damaging	1.00
IGL02352:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02359:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02391:Usp24	APN	4	106407129	missense	possibly damaging	0.60
IGL02418:Usp24	APN	4	106436360	missense	probably benign	0.07
IGL02537:Usp24	APN	4	106392367	missense	probably damaging	1.00
IGL02638:Usp24	APN	4	106438770	splice site	probably benign
IGL02638:Usp24	APN	4	106438772	splice site	probably benign
IGL02830:Usp24	APN	4	106347387	missense	possibly damaging	0.79
IGL03125:Usp24	APN	4	106392402	missense	probably benign	0.09
IGL03280:Usp24	APN	4	106380430	missense	probably damaging	1.00
IGL03350:Usp24	APN	4	106371079	nonsense	probably null
BB010:Usp24	UTSW	4	106428489	missense	probably benign
BB020:Usp24	UTSW	4	106428489	missense	probably benign
IGL03098:Usp24	UTSW	4	106371033	missense	probably benign	0.11
R0035:Usp24	UTSW	4	106368027	missense	probably benign	0.18
R0044:Usp24	UTSW	4	106412084	splice site	probably benign
R0086:Usp24	UTSW	4	106392360	missense	probably damaging	0.98
R0125:Usp24	UTSW	4	106397299	missense	possibly damaging	0.76
R0197:Usp24	UTSW	4	106407133	missense	probably damaging	1.00
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0491:Usp24	UTSW	4	106402105	missense	probably benign	0.41
R0687:Usp24	UTSW	4	106420504	missense	probably damaging	1.00
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0973:Usp24	UTSW	4	106413678	splice site	probably null
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106413678	splice site	probably null
R1163:Usp24	UTSW	4	106420960	missense	probably benign
R1293:Usp24	UTSW	4	106423553	missense	probably benign	0.19
R1333:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R1476:Usp24	UTSW	4	106361933	missense	probably damaging	1.00
R1699:Usp24	UTSW	4	106438827	missense	probably damaging	0.99
R1728:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1729:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1753:Usp24	UTSW	4	106377559	missense	probably benign	0.04
R1917:Usp24	UTSW	4	106410286	missense	probably damaging	1.00
R2045:Usp24	UTSW	4	106400980	missense	possibly damaging	0.54
R2424:Usp24	UTSW	4	106399113	critical splice donor site	probably null
R2436:Usp24	UTSW	4	106409645	nonsense	probably null
R2513:Usp24	UTSW	4	106379405	splice site	probably null
R3824:Usp24	UTSW	4	106379066	missense	probably benign
R3831:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3833:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3982:Usp24	UTSW	4	106387883	missense	probably benign	0.38
R4022:Usp24	UTSW	4	106379224	splice site	probably benign
R4067:Usp24	UTSW	4	106359089	missense	possibly damaging	0.68
R4175:Usp24	UTSW	4	106316773	missense	probably benign	0.00
R4766:Usp24	UTSW	4	106416048	missense	probably damaging	1.00
R4771:Usp24	UTSW	4	106362180	splice site	probably null
R4798:Usp24	UTSW	4	106360162	missense	possibly damaging	0.82
R4809:Usp24	UTSW	4	106413676	critical splice donor site	probably null
R4822:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R4906:Usp24	UTSW	4	106388637	missense	probably benign	0.20
R4934:Usp24	UTSW	4	106426546	missense	probably benign	0.29
R5074:Usp24	UTSW	4	106420447	missense	probably benign	0.12
R5151:Usp24	UTSW	4	106399112	critical splice donor site	probably null
R5220:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R5279:Usp24	UTSW	4	106385424	missense	possibly damaging	0.94
R5280:Usp24	UTSW	4	106341214	missense	probably benign	0.18
R5285:Usp24	UTSW	4	106407033	missense	probably benign	0.00
R5292:Usp24	UTSW	4	106418263	missense	probably benign	0.06
R5294:Usp24	UTSW	4	106362357	missense	possibly damaging	0.53
R5394:Usp24	UTSW	4	106408013	missense	probably damaging	1.00
R5517:Usp24	UTSW	4	106375674	missense	probably benign	0.02
R5522:Usp24	UTSW	4	106372721	missense	probably damaging	1.00
R5546:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R5756:Usp24	UTSW	4	106362483	missense	probably damaging	1.00
R5910:Usp24	UTSW	4	106380468	missense	probably damaging	0.99
R5972:Usp24	UTSW	4	106368067	missense	probably damaging	0.98
R6285:Usp24	UTSW	4	106374100	splice site	probably null
R6370:Usp24	UTSW	4	106380521	missense	probably null	0.20
R6630:Usp24	UTSW	4	106387835	missense	possibly damaging	0.69
R6754:Usp24	UTSW	4	106360420	missense	probably damaging	1.00
R7027:Usp24	UTSW	4	106362244	missense	probably benign	0.21
R7088:Usp24	UTSW	4	106387546	missense	probably damaging	1.00
R7129:Usp24	UTSW	4	106362215	missense	probably damaging	1.00
R7131:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R7156:Usp24	UTSW	4	106387919	critical splice donor site	probably null
R7174:Usp24	UTSW	4	106362681	splice site	probably null
R7236:Usp24	UTSW	4	106406305	splice site	probably null
R7403:Usp24	UTSW	4	106407035	missense	possibly damaging	0.79
R7424:Usp24	UTSW	4	106379107	missense	probably benign	0.00
R7475:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R7505:Usp24	UTSW	4	106379079	missense	probably damaging	1.00
R7782:Usp24	UTSW	4	106316574	missense	probably damaging	1.00
R7900:Usp24	UTSW	4	106409400	missense	probably damaging	1.00
R7933:Usp24	UTSW	4	106428489	missense	probably benign
R7940:Usp24	UTSW	4	106430544	missense	probably damaging	0.98
R8271:Usp24	UTSW	4	106428514	missense	probably damaging	0.98
R8348:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8448:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8483:Usp24	UTSW	4	106373756	missense	probably damaging	1.00
R8546:Usp24	UTSW	4	106402129	missense	probably benign	0.01
R8798:Usp24	UTSW	4	106379239	missense	probably benign	0.00
R8822:Usp24	UTSW	4	106412213	missense	probably benign	0.17
R8992:Usp24	UTSW	4	106377565	missense	probably benign	0.36
R9002:Usp24	UTSW	4	106418215	missense	possibly damaging	0.72
R9037:Usp24	UTSW	4	106379054	missense	probably damaging	0.99
R9068:Usp24	UTSW	4	106375678	missense	probably benign	0.09
R9096:Usp24	UTSW	4	106397311	missense	probably benign	0.00
R9180:Usp24	UTSW	4	106359050	missense	possibly damaging	0.71
R9199:Usp24	UTSW	4	106387484	missense	probably damaging	1.00
R9201:Usp24	UTSW	4	106420530	missense	probably benign	0.36
R9251:Usp24	UTSW	4	106360518	missense	probably benign	0.19
R9423:Usp24	UTSW	4	106431670	missense	probably damaging	1.00
R9459:Usp24	UTSW	4	106342358	missense	probably damaging	1.00
R9472:Usp24	UTSW	4	106403931	missense	probably benign	0.00
R9483:Usp24	UTSW	4	106362182	missense	probably damaging	0.99
R9534:Usp24	UTSW	4	106407115	missense	probably damaging	0.97
R9712:Usp24	UTSW	4	106347367	missense	probably benign	0.03
X0024:Usp24	UTSW	4	106360446	missense	probably benign	0.09
X0028:Usp24	UTSW	4	106368055	missense	probably benign	0.01
X0066:Usp24	UTSW	4	106355731	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- CCTTCACTAGCTGAGACCTGAG -3'
(R):5'- GGACTTTCTATTAACCAGATGCAG -3'

Sequencing Primer
(F):5'- AGTGTGCTGCAACAACTCTG -3'
(R):5'- ACCAGATGCAGTATTTCCTTTATTTC -3'

Posted On

2022-10-06