Incidental Mutation 'R9653:Usp24'
ID 727170
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Name ubiquitin specific peptidase 24
Synonyms 2810030C21Rik, 2700066K03Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9653 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 106316213-106441322 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106347367 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 261 (M261K)
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]
AlphaFold B1AY13
Predicted Effect probably benign
Transcript: ENSMUST00000094933
AA Change: M261K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: M261K

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165709
AA Change: M261K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: M261K

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,293,741 P1868L probably benign Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Adamtsl5 C T 10: 80,344,929 G100R probably damaging Het
Adgrg5 C T 8: 94,937,236 P235S Het
Anks1b T G 10: 90,510,662 L608R probably damaging Het
Ano10 C G 9: 122,251,155 A597P possibly damaging Het
Calb2 T C 8: 110,154,742 M58V probably benign Het
Ccdc180 T C 4: 45,923,495 I1092T probably damaging Het
Ces3b G T 8: 105,085,625 A169S probably damaging Het
Chmp2a A T 7: 13,032,529 F129I probably damaging Het
Clasp2 T A 9: 113,841,925 W365R probably benign Het
Col12a1 T C 9: 79,677,274 K1344R probably benign Het
Col3a1 A G 1: 45,321,568 I53V unknown Het
Coro2b T C 9: 62,427,977 Y309C probably damaging Het
Cramp1l C A 17: 24,982,809 K566N probably damaging Het
Crygs T A 16: 22,806,554 T46S probably benign Het
Ctbp2 C G 7: 133,014,204 R334P probably damaging Het
Dcstamp A T 15: 39,760,396 D469V probably benign Het
Dhdh T C 7: 45,479,127 D209G probably damaging Het
Dnah7b T C 1: 46,213,384 V1742A possibly damaging Het
Dnaja2 T C 8: 85,539,353 T368A probably benign Het
Dscaml1 T C 9: 45,732,168 probably null Het
Eps8l1 A T 7: 4,478,887 K704M unknown Het
Fam159b A G 13: 104,863,788 probably benign Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fgd4 T A 16: 16,436,597 H524L probably benign Het
Fktn T A 4: 53,731,273 F103I probably benign Het
Gcc2 T C 10: 58,275,000 M1001T possibly damaging Het
Gm4847 T C 1: 166,640,013 S205G possibly damaging Het
Grid2 A T 6: 63,930,984 N203Y possibly damaging Het
Hif3a G A 7: 17,048,716 A308V probably damaging Het
Htr5a A G 5: 27,842,840 N131S possibly damaging Het
Igfn1 G A 1: 135,955,585 Q2728* probably null Het
Ighv5-16 C A 12: 113,838,693 K62N possibly damaging Het
Ip6k3 A T 17: 27,148,614 Y203N possibly damaging Het
Itga2 G A 13: 114,884,455 P120L probably benign Het
Itpkb G T 1: 180,332,491 E61* probably null Het
Kcnj3 G A 2: 55,594,852 V321M probably damaging Het
Kmt2c A G 5: 25,302,821 L3206P probably damaging Het
Krtap5-4 T C 7: 142,304,171 C193R unknown Het
Large1 G T 8: 72,837,478 H553Q probably benign Het
Lrfn5 T A 12: 61,843,632 V569D probably damaging Het
Luzp2 A G 7: 55,052,832 T48A probably damaging Het
Lypd6 A T 2: 50,190,746 T149S probably benign Het
Map3k1 T C 13: 111,753,762 N1301S possibly damaging Het
Ndufv2 C T 17: 66,089,256 W91* probably null Het
Nisch A T 14: 31,171,671 V1315E probably damaging Het
Npas1 T C 7: 16,456,221 I467V probably benign Het
Nucb1 A G 7: 45,494,778 M337T probably benign Het
Olfr1315-ps1 A T 2: 112,110,916 M112K probably damaging Het
Olfr610 C T 7: 103,506,520 R142H probably benign Het
Olfr682-ps1 A T 7: 105,126,778 N164K probably benign Het
Olfr960 T C 9: 39,623,858 L243P probably damaging Het
Oog3 T G 4: 144,157,919 R482S probably benign Het
Padi2 T C 4: 140,934,725 probably null Het
Pam C T 1: 97,840,744 V660M possibly damaging Het
Phc2 C T 4: 128,747,219 L700F probably damaging Het
Plekha1 T C 7: 130,877,764 V4A possibly damaging Het
Rai1 A G 11: 60,189,316 E1402G probably benign Het
Recql5 G A 11: 115,897,206 A429V probably benign Het
Rere A G 4: 150,431,553 N101S probably benign Het
Robo1 T G 16: 73,024,442 S1357A possibly damaging Het
Rsl1 T A 13: 67,182,042 Y185N probably damaging Het
Rsph3a T C 17: 7,946,242 S145P possibly damaging Het
Sall1 T C 8: 89,030,878 E866G probably damaging Het
Sall3 A T 18: 80,973,013 S567T probably benign Het
Sap30 G A 8: 57,485,122 Q154* probably null Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Scn8a A G 15: 101,040,066 E1772G probably damaging Het
Scube3 C T 17: 28,156,798 A169V probably damaging Het
Sema6c T C 3: 95,173,214 S940P probably benign Het
Sertad4 C T 1: 192,846,528 D327N probably damaging Het
Skp1a A G 11: 52,243,687 T82A possibly damaging Het
Slc39a14 G T 14: 70,309,799 T366K probably damaging Het
Snrnp200 G T 2: 127,226,039 V819L probably damaging Het
Sntg1 T A 1: 8,363,525 T501S unknown Het
Srsf12 T C 4: 33,231,249 S253P possibly damaging Het
Sycp2l A G 13: 41,141,905 S315G probably benign Het
Tars2 T C 3: 95,748,067 Y337C probably damaging Het
Thbs4 T C 13: 92,761,514 D599G probably benign Het
Tmem200c A G 17: 68,842,186 H588R probably benign Het
Tmem255b T A 8: 13,456,005 V204E probably damaging Het
Utrn T A 10: 12,621,379 I2429F probably benign Het
Utrn C T 10: 12,663,445 A1943T probably benign Het
Vmn2r85 A T 10: 130,425,825 D214E probably damaging Het
Wdr81 G T 11: 75,449,387 P183T Het
Zfp28 G A 7: 6,392,624 R134H Het
Zfp532 T A 18: 65,623,237 D80E possibly damaging Het
Zfyve26 T C 12: 79,287,644 D200G probably benign Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106359091 missense probably benign
IGL00340:Usp24 APN 4 106401139 missense probably damaging 0.99
IGL00480:Usp24 APN 4 106368106 missense probably damaging 0.99
IGL00548:Usp24 APN 4 106341298 missense probably damaging 0.96
IGL00655:Usp24 APN 4 106390318 missense probably damaging 0.99
IGL00674:Usp24 APN 4 106372679 splice site probably benign
IGL00718:Usp24 APN 4 106409704 missense probably benign 0.10
IGL00803:Usp24 APN 4 106385526 splice site probably benign
IGL01161:Usp24 APN 4 106436844 missense probably benign 0.02
IGL01344:Usp24 APN 4 106379385 missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106380099 missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106362232 missense probably benign 0.01
IGL01736:Usp24 APN 4 106423461 missense probably benign 0.00
IGL01737:Usp24 APN 4 106387734 missense probably benign 0.03
IGL01862:Usp24 APN 4 106408898 splice site probably benign
IGL01981:Usp24 APN 4 106375768 splice site probably benign
IGL02090:Usp24 APN 4 106411426 missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106387493 missense probably damaging 1.00
IGL02352:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02359:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02391:Usp24 APN 4 106407129 missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106436360 missense probably benign 0.07
IGL02537:Usp24 APN 4 106392367 missense probably damaging 1.00
IGL02638:Usp24 APN 4 106438770 splice site probably benign
IGL02638:Usp24 APN 4 106438772 splice site probably benign
IGL02830:Usp24 APN 4 106347387 missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106392402 missense probably benign 0.09
IGL03280:Usp24 APN 4 106380430 missense probably damaging 1.00
IGL03350:Usp24 APN 4 106371079 nonsense probably null
BB010:Usp24 UTSW 4 106428489 missense probably benign
BB020:Usp24 UTSW 4 106428489 missense probably benign
IGL03098:Usp24 UTSW 4 106371033 missense probably benign 0.11
R0035:Usp24 UTSW 4 106368027 missense probably benign 0.18
R0044:Usp24 UTSW 4 106412084 splice site probably benign
R0086:Usp24 UTSW 4 106392360 missense probably damaging 0.98
R0125:Usp24 UTSW 4 106397299 missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106407133 missense probably damaging 1.00
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0491:Usp24 UTSW 4 106402105 missense probably benign 0.41
R0687:Usp24 UTSW 4 106420504 missense probably damaging 1.00
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0973:Usp24 UTSW 4 106413678 splice site probably null
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106413678 splice site probably null
R1163:Usp24 UTSW 4 106420960 missense probably benign
R1293:Usp24 UTSW 4 106423553 missense probably benign 0.19
R1333:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106361933 missense probably damaging 1.00
R1699:Usp24 UTSW 4 106438827 missense probably damaging 0.99
R1728:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106377559 missense probably benign 0.04
R1917:Usp24 UTSW 4 106410286 missense probably damaging 1.00
R2045:Usp24 UTSW 4 106400980 missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106399113 critical splice donor site probably null
R2436:Usp24 UTSW 4 106409645 nonsense probably null
R2513:Usp24 UTSW 4 106379405 splice site probably null
R3824:Usp24 UTSW 4 106379066 missense probably benign
R3831:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3833:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3982:Usp24 UTSW 4 106387883 missense probably benign 0.38
R4022:Usp24 UTSW 4 106379224 splice site probably benign
R4067:Usp24 UTSW 4 106359089 missense possibly damaging 0.68
R4175:Usp24 UTSW 4 106316773 missense probably benign 0.00
R4766:Usp24 UTSW 4 106416048 missense probably damaging 1.00
R4771:Usp24 UTSW 4 106362180 splice site probably null
R4798:Usp24 UTSW 4 106360162 missense possibly damaging 0.82
R4809:Usp24 UTSW 4 106413676 critical splice donor site probably null
R4822:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R4906:Usp24 UTSW 4 106388637 missense probably benign 0.20
R4934:Usp24 UTSW 4 106426546 missense probably benign 0.29
R5074:Usp24 UTSW 4 106420447 missense probably benign 0.12
R5151:Usp24 UTSW 4 106399112 critical splice donor site probably null
R5220:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106385424 missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106341214 missense probably benign 0.18
R5285:Usp24 UTSW 4 106407033 missense probably benign 0.00
R5292:Usp24 UTSW 4 106418263 missense probably benign 0.06
R5294:Usp24 UTSW 4 106362357 missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106408013 missense probably damaging 1.00
R5517:Usp24 UTSW 4 106375674 missense probably benign 0.02
R5522:Usp24 UTSW 4 106372721 missense probably damaging 1.00
R5546:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R5756:Usp24 UTSW 4 106362483 missense probably damaging 1.00
R5910:Usp24 UTSW 4 106380468 missense probably damaging 0.99
R5972:Usp24 UTSW 4 106368067 missense probably damaging 0.98
R6285:Usp24 UTSW 4 106374100 splice site probably null
R6370:Usp24 UTSW 4 106380521 missense probably null 0.20
R6630:Usp24 UTSW 4 106387835 missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106360420 missense probably damaging 1.00
R7027:Usp24 UTSW 4 106362244 missense probably benign 0.21
R7088:Usp24 UTSW 4 106387546 missense probably damaging 1.00
R7129:Usp24 UTSW 4 106362215 missense probably damaging 1.00
R7131:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R7156:Usp24 UTSW 4 106387919 critical splice donor site probably null
R7174:Usp24 UTSW 4 106362681 splice site probably null
R7236:Usp24 UTSW 4 106406305 splice site probably null
R7403:Usp24 UTSW 4 106407035 missense possibly damaging 0.79
R7424:Usp24 UTSW 4 106379107 missense probably benign 0.00
R7475:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R7505:Usp24 UTSW 4 106379079 missense probably damaging 1.00
R7782:Usp24 UTSW 4 106316574 missense probably damaging 1.00
R7900:Usp24 UTSW 4 106409400 missense probably damaging 1.00
R7933:Usp24 UTSW 4 106428489 missense probably benign
R7940:Usp24 UTSW 4 106430544 missense probably damaging 0.98
R8271:Usp24 UTSW 4 106428514 missense probably damaging 0.98
R8348:Usp24 UTSW 4 106368736 missense possibly damaging 0.82
R8448:Usp24 UTSW 4 106368736 missense possibly damaging 0.82
R8483:Usp24 UTSW 4 106373756 missense probably damaging 1.00
R8546:Usp24 UTSW 4 106402129 missense probably benign 0.01
R8798:Usp24 UTSW 4 106379239 missense probably benign 0.00
R8822:Usp24 UTSW 4 106412213 missense probably benign 0.17
R8992:Usp24 UTSW 4 106377565 missense probably benign 0.36
R9002:Usp24 UTSW 4 106418215 missense possibly damaging 0.72
R9037:Usp24 UTSW 4 106379054 missense probably damaging 0.99
R9068:Usp24 UTSW 4 106375678 missense probably benign 0.09
R9096:Usp24 UTSW 4 106397311 missense probably benign 0.00
R9180:Usp24 UTSW 4 106359050 missense possibly damaging 0.71
R9199:Usp24 UTSW 4 106387484 missense probably damaging 1.00
R9201:Usp24 UTSW 4 106420530 missense probably benign 0.36
R9251:Usp24 UTSW 4 106360518 missense probably benign 0.19
R9423:Usp24 UTSW 4 106431670 missense probably damaging 1.00
R9459:Usp24 UTSW 4 106342358 missense probably damaging 1.00
R9472:Usp24 UTSW 4 106403931 missense probably benign 0.00
R9483:Usp24 UTSW 4 106362182 missense probably damaging 0.99
R9534:Usp24 UTSW 4 106407115 missense probably damaging 0.97
R9712:Usp24 UTSW 4 106347367 missense probably benign 0.03
X0024:Usp24 UTSW 4 106360446 missense probably benign 0.09
X0028:Usp24 UTSW 4 106368055 missense probably benign 0.01
X0066:Usp24 UTSW 4 106355731 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCTTCACTAGCTGAGACCTGAG -3'
(R):5'- GGACTTTCTATTAACCAGATGCAG -3'

Sequencing Primer
(F):5'- AGTGTGCTGCAACAACTCTG -3'
(R):5'- ACCAGATGCAGTATTTCCTTTATTTC -3'
Posted On 2022-10-06