Incidental Mutation 'R9653:Kmt2c'
ID 727175
Institutional Source Beutler Lab
Gene Symbol Kmt2c
Ensembl Gene ENSMUSG00000038056
Gene Name lysine (K)-specific methyltransferase 2C
Synonyms Mll3, HALR, E330008K23Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9653 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 25476796-25703781 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25507819 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 3206 (L3206P)
Ref Sequence ENSEMBL: ENSMUSP00000043874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000174734]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000045291
AA Change: L3206P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: L3206P

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 898 910 1.41e2 SMART
PHD 953 1002 2.89e-10 SMART
RING 954 1001 4.74e0 SMART
C1 994 1045 8.38e-2 SMART
PHD 1003 1049 1.05e-12 SMART
PHD 1080 1131 2.08e-2 SMART
low complexity region 1189 1201 N/A INTRINSIC
low complexity region 1337 1348 N/A INTRINSIC
low complexity region 1394 1406 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1520 1539 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
HMG 1639 1703 2.64e-3 SMART
low complexity region 1708 1724 N/A INTRINSIC
coiled coil region 1745 1789 N/A INTRINSIC
low complexity region 1847 1860 N/A INTRINSIC
low complexity region 1864 1891 N/A INTRINSIC
internal_repeat_3 1893 2084 1.27e-14 PROSPERO
internal_repeat_3 2123 2306 1.27e-14 PROSPERO
low complexity region 2336 2348 N/A INTRINSIC
low complexity region 2375 2394 N/A INTRINSIC
low complexity region 2427 2440 N/A INTRINSIC
low complexity region 2516 2527 N/A INTRINSIC
low complexity region 2696 2720 N/A INTRINSIC
low complexity region 2723 2742 N/A INTRINSIC
low complexity region 2930 2943 N/A INTRINSIC
coiled coil region 3048 3075 N/A INTRINSIC
low complexity region 3156 3165 N/A INTRINSIC
low complexity region 3173 3195 N/A INTRINSIC
coiled coil region 3226 3270 N/A INTRINSIC
low complexity region 3277 3290 N/A INTRINSIC
coiled coil region 3389 3427 N/A INTRINSIC
low complexity region 3460 3486 N/A INTRINSIC
low complexity region 3597 3611 N/A INTRINSIC
low complexity region 3649 3667 N/A INTRINSIC
low complexity region 3769 3783 N/A INTRINSIC
low complexity region 3822 3827 N/A INTRINSIC
low complexity region 3860 3869 N/A INTRINSIC
low complexity region 3887 3904 N/A INTRINSIC
low complexity region 3994 4009 N/A INTRINSIC
low complexity region 4015 4038 N/A INTRINSIC
low complexity region 4293 4309 N/A INTRINSIC
low complexity region 4412 4419 N/A INTRINSIC
PHD 4454 4500 2.94e-2 SMART
RING 4455 4499 8.1e0 SMART
FYRN 4554 4597 1.18e-21 SMART
FYRC 4603 4690 4.54e-32 SMART
SET 4764 4886 3.17e-34 SMART
PostSET 4888 4904 1.82e-6 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000133941
Gene: ENSMUSG00000038056
AA Change: L124P

DomainStartEndE-ValueType
SCOP:d2spca_ 84 177 1e-3 SMART
low complexity region 196 209 N/A INTRINSIC
coiled coil region 307 345 N/A INTRINSIC
low complexity region 379 405 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 568 586 N/A INTRINSIC
low complexity region 688 702 N/A INTRINSIC
low complexity region 735 752 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
low complexity region 863 886 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1260 1267 N/A INTRINSIC
PHD 1302 1348 2.94e-2 SMART
FYRN 1402 1445 1.18e-21 SMART
FYRC 1451 1538 4.54e-32 SMART
SET 1608 1730 3.17e-34 SMART
PostSET 1732 1748 1.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174734
SMART Domains Protein: ENSMUSP00000133482
Gene: ENSMUSG00000038056

DomainStartEndE-ValueType
low complexity region 49 75 N/A INTRINSIC
low complexity region 186 200 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
low complexity region 358 372 N/A INTRINSIC
low complexity region 411 416 N/A INTRINSIC
low complexity region 449 458 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 635 658 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
low complexity region 1032 1039 N/A INTRINSIC
PHD 1074 1120 2.94e-2 SMART
FYRN 1174 1217 1.18e-21 SMART
FYRC 1223 1310 4.54e-32 SMART
SET 1384 1506 3.17e-34 SMART
PostSET 1508 1524 1.82e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 C T 11: 9,243,741 (GRCm39) P1868L probably benign Het
Abcc1 T C 16: 14,214,257 (GRCm39) Y191H probably damaging Het
Adamtsl5 C T 10: 80,180,763 (GRCm39) G100R probably damaging Het
Adgrg5 C T 8: 95,663,864 (GRCm39) P235S Het
Anks1b T G 10: 90,346,524 (GRCm39) L608R probably damaging Het
Ano10 C G 9: 122,080,221 (GRCm39) A597P possibly damaging Het
Calb2 T C 8: 110,881,374 (GRCm39) M58V probably benign Het
Ccdc180 T C 4: 45,923,495 (GRCm39) I1092T probably damaging Het
Ces3b G T 8: 105,812,257 (GRCm39) A169S probably damaging Het
Chmp2a A T 7: 12,766,456 (GRCm39) F129I probably damaging Het
Clasp2 T A 9: 113,670,993 (GRCm39) W365R probably benign Het
Col12a1 T C 9: 79,584,556 (GRCm39) K1344R probably benign Het
Col3a1 A G 1: 45,360,728 (GRCm39) I53V unknown Het
Coro2b T C 9: 62,335,259 (GRCm39) Y309C probably damaging Het
Cramp1 C A 17: 25,201,783 (GRCm39) K566N probably damaging Het
Crygs T A 16: 22,625,304 (GRCm39) T46S probably benign Het
Ctbp2 C G 7: 132,615,933 (GRCm39) R334P probably damaging Het
Dcstamp A T 15: 39,623,792 (GRCm39) D469V probably benign Het
Dhdh T C 7: 45,128,551 (GRCm39) D209G probably damaging Het
Dnah7b T C 1: 46,252,544 (GRCm39) V1742A possibly damaging Het
Dnaja2 T C 8: 86,265,982 (GRCm39) T368A probably benign Het
Dscaml1 T C 9: 45,643,466 (GRCm39) probably null Het
Eps8l1 A T 7: 4,481,886 (GRCm39) K704M unknown Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Fgd4 T A 16: 16,254,461 (GRCm39) H524L probably benign Het
Fktn T A 4: 53,731,273 (GRCm39) F103I probably benign Het
Gcc2 T C 10: 58,110,822 (GRCm39) M1001T possibly damaging Het
Gm4847 T C 1: 166,467,582 (GRCm39) S205G possibly damaging Het
Grid2 A T 6: 63,907,968 (GRCm39) N203Y possibly damaging Het
Hif3a G A 7: 16,782,641 (GRCm39) A308V probably damaging Het
Htr5a A G 5: 28,047,838 (GRCm39) N131S possibly damaging Het
Igfn1 G A 1: 135,883,323 (GRCm39) Q2728* probably null Het
Ighv5-16 C A 12: 113,802,313 (GRCm39) K62N possibly damaging Het
Ip6k3 A T 17: 27,367,588 (GRCm39) Y203N possibly damaging Het
Itga2 G A 13: 115,020,991 (GRCm39) P120L probably benign Het
Itpkb G T 1: 180,160,056 (GRCm39) E61* probably null Het
Kcnj3 G A 2: 55,484,864 (GRCm39) V321M probably damaging Het
Krtap5-4 T C 7: 141,857,908 (GRCm39) C193R unknown Het
Large1 G T 8: 73,564,106 (GRCm39) H553Q probably benign Het
Lrfn5 T A 12: 61,890,418 (GRCm39) V569D probably damaging Het
Luzp2 A G 7: 54,702,580 (GRCm39) T48A probably damaging Het
Lypd6 A T 2: 50,080,758 (GRCm39) T149S probably benign Het
Map3k1 T C 13: 111,890,296 (GRCm39) N1301S possibly damaging Het
Ndufv2 C T 17: 66,396,251 (GRCm39) W91* probably null Het
Nisch A T 14: 30,893,628 (GRCm39) V1315E probably damaging Het
Npas1 T C 7: 16,190,146 (GRCm39) I467V probably benign Het
Nucb1 A G 7: 45,144,202 (GRCm39) M337T probably benign Het
Oog3 T G 4: 143,884,489 (GRCm39) R482S probably benign Het
Or10d4b T C 9: 39,535,154 (GRCm39) L243P probably damaging Het
Or4f14c A T 2: 111,941,261 (GRCm39) M112K probably damaging Het
Or51ag1 C T 7: 103,155,727 (GRCm39) R142H probably benign Het
Or56a42-ps1 A T 7: 104,775,985 (GRCm39) N164K probably benign Het
Padi2 T C 4: 140,662,036 (GRCm39) probably null Het
Pam C T 1: 97,768,469 (GRCm39) V660M possibly damaging Het
Phc2 C T 4: 128,641,012 (GRCm39) L700F probably damaging Het
Plekha1 T C 7: 130,479,494 (GRCm39) V4A possibly damaging Het
Rai1 A G 11: 60,080,142 (GRCm39) E1402G probably benign Het
Recql5 G A 11: 115,788,032 (GRCm39) A429V probably benign Het
Rere A G 4: 150,516,010 (GRCm39) N101S probably benign Het
Robo1 T G 16: 72,821,330 (GRCm39) S1357A possibly damaging Het
Rsl1 T A 13: 67,330,106 (GRCm39) Y185N probably damaging Het
Rsph3a T C 17: 8,165,074 (GRCm39) S145P possibly damaging Het
Sall1 T C 8: 89,757,506 (GRCm39) E866G probably damaging Het
Sall3 A T 18: 81,016,228 (GRCm39) S567T probably benign Het
Sap30 G A 8: 57,938,156 (GRCm39) Q154* probably null Het
Sbf2 T C 7: 110,040,702 (GRCm39) Q375R possibly damaging Het
Scn8a A G 15: 100,937,947 (GRCm39) E1772G probably damaging Het
Scube3 C T 17: 28,375,772 (GRCm39) A169V probably damaging Het
Sema6c T C 3: 95,080,525 (GRCm39) S940P probably benign Het
Sertad4 C T 1: 192,528,836 (GRCm39) D327N probably damaging Het
Shisal2b A G 13: 105,000,296 (GRCm39) probably benign Het
Skp1 A G 11: 52,134,514 (GRCm39) T82A possibly damaging Het
Slc39a14 G T 14: 70,547,248 (GRCm39) T366K probably damaging Het
Snrnp200 G T 2: 127,067,959 (GRCm39) V819L probably damaging Het
Sntg1 T A 1: 8,433,749 (GRCm39) T501S unknown Het
Srsf12 T C 4: 33,231,249 (GRCm39) S253P possibly damaging Het
Sycp2l A G 13: 41,295,381 (GRCm39) S315G probably benign Het
Tars2 T C 3: 95,655,379 (GRCm39) Y337C probably damaging Het
Thbs4 T C 13: 92,898,022 (GRCm39) D599G probably benign Het
Tmem200c A G 17: 69,149,181 (GRCm39) H588R probably benign Het
Tmem255b T A 8: 13,506,005 (GRCm39) V204E probably damaging Het
Usp24 T A 4: 106,204,564 (GRCm39) M261K probably benign Het
Utrn T A 10: 12,497,123 (GRCm39) I2429F probably benign Het
Utrn C T 10: 12,539,189 (GRCm39) A1943T probably benign Het
Vmn2r85 A T 10: 130,261,694 (GRCm39) D214E probably damaging Het
Wdr81 G T 11: 75,340,213 (GRCm39) P183T Het
Zfp28 G A 7: 6,395,623 (GRCm39) R134H Het
Zfp532 T A 18: 65,756,308 (GRCm39) D80E possibly damaging Het
Zfyve26 T C 12: 79,334,418 (GRCm39) D200G probably benign Het
Other mutations in Kmt2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Kmt2c APN 5 25,486,259 (GRCm39) missense probably damaging 0.99
IGL00694:Kmt2c APN 5 25,498,159 (GRCm39) missense probably damaging 0.99
IGL00780:Kmt2c APN 5 25,516,049 (GRCm39) missense probably benign 0.00
IGL00811:Kmt2c APN 5 25,579,531 (GRCm39) missense possibly damaging 0.75
IGL00885:Kmt2c APN 5 25,614,169 (GRCm39) missense possibly damaging 0.80
IGL00948:Kmt2c APN 5 25,582,159 (GRCm39) missense probably benign 0.08
IGL00959:Kmt2c APN 5 25,481,227 (GRCm39) missense probably damaging 1.00
IGL01022:Kmt2c APN 5 25,507,699 (GRCm39) unclassified probably benign
IGL01146:Kmt2c APN 5 25,513,510 (GRCm39) missense probably damaging 0.96
IGL01154:Kmt2c APN 5 25,489,397 (GRCm39) missense probably damaging 1.00
IGL01434:Kmt2c APN 5 25,614,306 (GRCm39) missense probably damaging 1.00
IGL01464:Kmt2c APN 5 25,557,242 (GRCm39) missense possibly damaging 0.90
IGL01525:Kmt2c APN 5 25,534,439 (GRCm39) splice site probably benign
IGL01530:Kmt2c APN 5 25,518,498 (GRCm39) missense probably benign 0.08
IGL01550:Kmt2c APN 5 25,486,274 (GRCm39) missense probably damaging 1.00
IGL01598:Kmt2c APN 5 25,478,664 (GRCm39) makesense probably null
IGL01598:Kmt2c APN 5 25,559,769 (GRCm39) missense probably damaging 1.00
IGL01608:Kmt2c APN 5 25,559,809 (GRCm39) missense probably damaging 0.97
IGL01663:Kmt2c APN 5 25,515,668 (GRCm39) missense probably damaging 1.00
IGL01707:Kmt2c APN 5 25,505,096 (GRCm39) missense probably damaging 1.00
IGL01714:Kmt2c APN 5 25,518,398 (GRCm39) missense probably benign
IGL01784:Kmt2c APN 5 25,518,524 (GRCm39) missense probably damaging 1.00
IGL01813:Kmt2c APN 5 25,495,802 (GRCm39) missense possibly damaging 0.82
IGL01825:Kmt2c APN 5 25,515,594 (GRCm39) missense probably damaging 1.00
IGL01834:Kmt2c APN 5 25,600,453 (GRCm39) missense probably benign 0.05
IGL02072:Kmt2c APN 5 25,610,430 (GRCm39) missense possibly damaging 0.96
IGL02159:Kmt2c APN 5 25,516,341 (GRCm39) missense probably benign 0.18
IGL02303:Kmt2c APN 5 25,515,155 (GRCm39) missense probably damaging 0.96
IGL02417:Kmt2c APN 5 25,578,018 (GRCm39) missense probably benign
IGL02578:Kmt2c APN 5 25,571,198 (GRCm39) intron probably benign
IGL02811:Kmt2c APN 5 25,520,026 (GRCm39) nonsense probably null
IGL02943:Kmt2c APN 5 25,495,821 (GRCm39) missense probably damaging 1.00
IGL03000:Kmt2c APN 5 25,489,170 (GRCm39) missense probably damaging 1.00
IGL03040:Kmt2c APN 5 25,515,350 (GRCm39) missense probably benign
IGL03076:Kmt2c APN 5 25,504,149 (GRCm39) nonsense probably null
IGL03088:Kmt2c APN 5 25,504,802 (GRCm39) missense probably damaging 0.99
IGL03131:Kmt2c APN 5 25,520,359 (GRCm39) missense probably benign 0.00
FR4304:Kmt2c UTSW 5 25,520,764 (GRCm39) small insertion probably benign
FR4976:Kmt2c UTSW 5 25,520,761 (GRCm39) small insertion probably benign
PIT4520001:Kmt2c UTSW 5 25,520,664 (GRCm39) missense probably benign 0.12
PIT4585001:Kmt2c UTSW 5 25,520,104 (GRCm39) missense probably benign 0.21
R0313:Kmt2c UTSW 5 25,549,928 (GRCm39) missense probably damaging 1.00
R0374:Kmt2c UTSW 5 25,514,706 (GRCm39) missense probably damaging 1.00
R0411:Kmt2c UTSW 5 25,580,955 (GRCm39) missense probably damaging 1.00
R0422:Kmt2c UTSW 5 25,520,662 (GRCm39) missense probably benign
R0453:Kmt2c UTSW 5 25,559,745 (GRCm39) missense probably damaging 1.00
R0616:Kmt2c UTSW 5 25,504,250 (GRCm39) missense probably benign
R0619:Kmt2c UTSW 5 25,503,914 (GRCm39) missense probably benign 0.21
R0671:Kmt2c UTSW 5 25,609,363 (GRCm39) missense probably damaging 1.00
R0736:Kmt2c UTSW 5 25,500,432 (GRCm39) missense probably benign
R0745:Kmt2c UTSW 5 25,564,696 (GRCm39) splice site probably null
R0760:Kmt2c UTSW 5 25,558,315 (GRCm39) missense possibly damaging 0.68
R0784:Kmt2c UTSW 5 25,515,893 (GRCm39) missense probably benign 0.00
R0882:Kmt2c UTSW 5 25,500,605 (GRCm39) missense possibly damaging 0.90
R0893:Kmt2c UTSW 5 25,556,268 (GRCm39) splice site probably benign
R0942:Kmt2c UTSW 5 25,520,301 (GRCm39) missense probably benign 0.10
R1110:Kmt2c UTSW 5 25,519,360 (GRCm39) missense probably benign 0.01
R1137:Kmt2c UTSW 5 25,515,981 (GRCm39) missense possibly damaging 0.80
R1255:Kmt2c UTSW 5 25,556,151 (GRCm39) missense probably damaging 1.00
R1300:Kmt2c UTSW 5 25,610,452 (GRCm39) missense probably damaging 0.99
R1497:Kmt2c UTSW 5 25,519,513 (GRCm39) missense possibly damaging 0.80
R1594:Kmt2c UTSW 5 25,519,876 (GRCm39) missense probably benign 0.01
R1611:Kmt2c UTSW 5 25,564,309 (GRCm39) critical splice donor site probably null
R1617:Kmt2c UTSW 5 25,580,925 (GRCm39) missense probably benign 0.01
R1720:Kmt2c UTSW 5 25,504,182 (GRCm39) missense probably benign 0.05
R1723:Kmt2c UTSW 5 25,520,003 (GRCm39) missense probably damaging 1.00
R1724:Kmt2c UTSW 5 25,520,003 (GRCm39) missense probably damaging 1.00
R1726:Kmt2c UTSW 5 25,520,003 (GRCm39) missense probably damaging 1.00
R1736:Kmt2c UTSW 5 25,495,525 (GRCm39) missense probably damaging 1.00
R1778:Kmt2c UTSW 5 25,577,972 (GRCm39) missense probably benign 0.02
R1809:Kmt2c UTSW 5 25,489,190 (GRCm39) missense probably damaging 1.00
R1845:Kmt2c UTSW 5 25,578,434 (GRCm39) missense probably benign 0.45
R1895:Kmt2c UTSW 5 25,520,152 (GRCm39) missense probably benign 0.34
R1946:Kmt2c UTSW 5 25,520,152 (GRCm39) missense probably benign 0.34
R1989:Kmt2c UTSW 5 25,703,542 (GRCm39) missense possibly damaging 0.93
R2039:Kmt2c UTSW 5 25,534,038 (GRCm39) missense possibly damaging 0.53
R2049:Kmt2c UTSW 5 25,490,077 (GRCm39) missense probably damaging 1.00
R2079:Kmt2c UTSW 5 25,557,278 (GRCm39) missense possibly damaging 0.82
R2080:Kmt2c UTSW 5 25,559,715 (GRCm39) missense probably damaging 1.00
R2107:Kmt2c UTSW 5 25,514,822 (GRCm39) missense probably benign 0.01
R2186:Kmt2c UTSW 5 25,492,110 (GRCm39) missense probably damaging 1.00
R2395:Kmt2c UTSW 5 25,520,150 (GRCm39) missense probably benign
R2983:Kmt2c UTSW 5 25,520,755 (GRCm39) small deletion probably benign
R3109:Kmt2c UTSW 5 25,480,733 (GRCm39) missense probably damaging 1.00
R3500:Kmt2c UTSW 5 25,504,477 (GRCm39) missense probably benign 0.02
R3738:Kmt2c UTSW 5 25,610,381 (GRCm39) missense probably benign 0.41
R3809:Kmt2c UTSW 5 25,614,136 (GRCm39) missense possibly damaging 0.87
R4088:Kmt2c UTSW 5 25,492,711 (GRCm39) missense probably benign
R4107:Kmt2c UTSW 5 25,503,918 (GRCm39) missense possibly damaging 0.51
R4212:Kmt2c UTSW 5 25,552,357 (GRCm39) critical splice donor site probably null
R4376:Kmt2c UTSW 5 25,520,324 (GRCm39) missense probably benign 0.00
R4377:Kmt2c UTSW 5 25,520,324 (GRCm39) missense probably benign 0.00
R4383:Kmt2c UTSW 5 25,556,060 (GRCm39) missense possibly damaging 0.77
R4435:Kmt2c UTSW 5 25,519,875 (GRCm39) missense possibly damaging 0.63
R4456:Kmt2c UTSW 5 25,515,210 (GRCm39) missense probably benign
R4461:Kmt2c UTSW 5 25,504,874 (GRCm39) missense probably benign 0.00
R4519:Kmt2c UTSW 5 25,568,475 (GRCm39) missense probably damaging 1.00
R4550:Kmt2c UTSW 5 25,505,172 (GRCm39) missense probably damaging 1.00
R4557:Kmt2c UTSW 5 25,505,313 (GRCm39) missense probably damaging 1.00
R4610:Kmt2c UTSW 5 25,559,382 (GRCm39) missense probably damaging 1.00
R4671:Kmt2c UTSW 5 25,571,175 (GRCm39) missense probably damaging 1.00
R4704:Kmt2c UTSW 5 25,519,025 (GRCm39) nonsense probably null
R4781:Kmt2c UTSW 5 25,648,823 (GRCm39) missense probably damaging 1.00
R4844:Kmt2c UTSW 5 25,520,111 (GRCm39) missense probably benign
R4855:Kmt2c UTSW 5 25,519,555 (GRCm39) missense probably benign 0.00
R4919:Kmt2c UTSW 5 25,519,393 (GRCm39) missense possibly damaging 0.80
R4971:Kmt2c UTSW 5 25,515,870 (GRCm39) missense probably benign 0.00
R4983:Kmt2c UTSW 5 25,500,509 (GRCm39) missense possibly damaging 0.51
R5012:Kmt2c UTSW 5 25,504,710 (GRCm39) nonsense probably null
R5033:Kmt2c UTSW 5 25,519,706 (GRCm39) missense probably benign 0.03
R5093:Kmt2c UTSW 5 25,614,205 (GRCm39) missense probably benign 0.17
R5125:Kmt2c UTSW 5 25,489,379 (GRCm39) missense probably damaging 0.99
R5231:Kmt2c UTSW 5 25,520,471 (GRCm39) missense possibly damaging 0.89
R5254:Kmt2c UTSW 5 25,519,592 (GRCm39) missense probably benign 0.01
R5396:Kmt2c UTSW 5 25,499,732 (GRCm39) splice site probably null
R5415:Kmt2c UTSW 5 25,519,699 (GRCm39) missense probably benign 0.21
R5523:Kmt2c UTSW 5 25,504,337 (GRCm39) missense probably benign 0.00
R5554:Kmt2c UTSW 5 25,499,608 (GRCm39) missense probably damaging 1.00
R5701:Kmt2c UTSW 5 25,519,015 (GRCm39) missense probably benign 0.16
R5762:Kmt2c UTSW 5 25,515,455 (GRCm39) missense probably benign 0.01
R5819:Kmt2c UTSW 5 25,614,130 (GRCm39) critical splice donor site probably null
R5838:Kmt2c UTSW 5 25,489,469 (GRCm39) missense probably damaging 1.00
R5912:Kmt2c UTSW 5 25,552,467 (GRCm39) missense possibly damaging 0.80
R5951:Kmt2c UTSW 5 25,535,801 (GRCm39) missense probably benign 0.15
R5988:Kmt2c UTSW 5 25,516,118 (GRCm39) missense probably benign 0.02
R5999:Kmt2c UTSW 5 25,489,203 (GRCm39) missense probably damaging 1.00
R6104:Kmt2c UTSW 5 25,504,127 (GRCm39) missense probably benign
R6254:Kmt2c UTSW 5 25,554,872 (GRCm39) missense possibly damaging 0.94
R6311:Kmt2c UTSW 5 25,648,816 (GRCm39) critical splice donor site probably null
R6329:Kmt2c UTSW 5 25,520,600 (GRCm39) missense probably benign 0.01
R6347:Kmt2c UTSW 5 25,515,833 (GRCm39) missense possibly damaging 0.54
R6364:Kmt2c UTSW 5 25,514,634 (GRCm39) missense probably null 0.99
R6379:Kmt2c UTSW 5 25,564,339 (GRCm39) missense probably damaging 1.00
R6588:Kmt2c UTSW 5 25,528,787 (GRCm39) missense probably damaging 0.99
R6628:Kmt2c UTSW 5 25,503,926 (GRCm39) missense probably benign
R6733:Kmt2c UTSW 5 25,614,291 (GRCm39) missense probably damaging 1.00
R6787:Kmt2c UTSW 5 25,480,737 (GRCm39) splice site probably null
R6816:Kmt2c UTSW 5 25,610,530 (GRCm39) splice site probably null
R6862:Kmt2c UTSW 5 25,515,515 (GRCm39) missense probably damaging 1.00
R7150:Kmt2c UTSW 5 25,505,360 (GRCm39) missense possibly damaging 0.89
R7220:Kmt2c UTSW 5 25,549,923 (GRCm39) missense probably damaging 1.00
R7250:Kmt2c UTSW 5 25,514,805 (GRCm39) missense probably benign 0.00
R7250:Kmt2c UTSW 5 25,504,489 (GRCm39) missense probably damaging 1.00
R7402:Kmt2c UTSW 5 25,600,418 (GRCm39) missense probably damaging 1.00
R7465:Kmt2c UTSW 5 25,507,847 (GRCm39) missense probably damaging 1.00
R7467:Kmt2c UTSW 5 25,513,530 (GRCm39) missense probably damaging 1.00
R7491:Kmt2c UTSW 5 25,489,562 (GRCm39) missense probably damaging 0.99
R7549:Kmt2c UTSW 5 25,619,968 (GRCm39) missense possibly damaging 0.95
R7637:Kmt2c UTSW 5 25,520,093 (GRCm39) missense probably damaging 1.00
R7652:Kmt2c UTSW 5 25,520,717 (GRCm39) missense probably benign 0.01
R7714:Kmt2c UTSW 5 25,580,364 (GRCm39) missense probably benign
R7838:Kmt2c UTSW 5 25,499,697 (GRCm39) missense possibly damaging 0.57
R7891:Kmt2c UTSW 5 25,505,109 (GRCm39) missense probably damaging 1.00
R7892:Kmt2c UTSW 5 25,504,814 (GRCm39) missense probably benign 0.18
R7895:Kmt2c UTSW 5 25,578,174 (GRCm39) missense possibly damaging 0.65
R7960:Kmt2c UTSW 5 25,520,194 (GRCm39) missense probably benign 0.01
R7974:Kmt2c UTSW 5 25,505,561 (GRCm39) missense probably damaging 1.00
R7978:Kmt2c UTSW 5 25,564,676 (GRCm39) missense probably benign 0.00
R8011:Kmt2c UTSW 5 25,556,232 (GRCm39) missense probably damaging 0.99
R8021:Kmt2c UTSW 5 25,492,117 (GRCm39) missense possibly damaging 0.88
R8022:Kmt2c UTSW 5 25,486,678 (GRCm39) missense possibly damaging 0.83
R8079:Kmt2c UTSW 5 25,507,730 (GRCm39) missense probably damaging 0.98
R8087:Kmt2c UTSW 5 25,534,250 (GRCm39) missense probably damaging 1.00
R8109:Kmt2c UTSW 5 25,486,382 (GRCm39) missense probably damaging 1.00
R8161:Kmt2c UTSW 5 25,579,562 (GRCm39) missense probably benign 0.00
R8169:Kmt2c UTSW 5 25,559,685 (GRCm39) missense probably damaging 1.00
R8206:Kmt2c UTSW 5 25,519,537 (GRCm39) missense probably damaging 0.98
R8218:Kmt2c UTSW 5 25,488,104 (GRCm39) missense probably damaging 1.00
R8223:Kmt2c UTSW 5 25,529,216 (GRCm39) missense possibly damaging 0.89
R8260:Kmt2c UTSW 5 25,610,514 (GRCm39) missense possibly damaging 0.87
R8330:Kmt2c UTSW 5 25,509,692 (GRCm39) missense probably null 1.00
R8355:Kmt2c UTSW 5 25,559,499 (GRCm39) critical splice acceptor site probably null
R8455:Kmt2c UTSW 5 25,559,499 (GRCm39) critical splice acceptor site probably null
R8508:Kmt2c UTSW 5 25,519,120 (GRCm39) missense probably benign 0.34
R8885:Kmt2c UTSW 5 25,520,077 (GRCm39) missense probably benign 0.34
R8907:Kmt2c UTSW 5 25,514,609 (GRCm39) missense probably damaging 1.00
R8924:Kmt2c UTSW 5 25,503,885 (GRCm39) missense probably benign
R8969:Kmt2c UTSW 5 25,519,387 (GRCm39) missense possibly damaging 0.82
R9019:Kmt2c UTSW 5 25,488,208 (GRCm39) missense probably damaging 1.00
R9035:Kmt2c UTSW 5 25,524,010 (GRCm39) missense probably damaging 1.00
R9074:Kmt2c UTSW 5 25,489,343 (GRCm39) missense probably damaging 1.00
R9125:Kmt2c UTSW 5 25,489,194 (GRCm39) missense possibly damaging 0.86
R9130:Kmt2c UTSW 5 25,516,102 (GRCm39) missense probably benign 0.01
R9171:Kmt2c UTSW 5 25,486,309 (GRCm39) missense probably damaging 1.00
R9235:Kmt2c UTSW 5 25,504,997 (GRCm39) missense probably damaging 1.00
R9288:Kmt2c UTSW 5 25,554,860 (GRCm39) missense probably benign 0.34
R9288:Kmt2c UTSW 5 25,497,907 (GRCm39) missense probably damaging 1.00
R9336:Kmt2c UTSW 5 25,614,165 (GRCm39) missense probably benign 0.06
R9443:Kmt2c UTSW 5 25,515,045 (GRCm39) missense probably damaging 1.00
R9481:Kmt2c UTSW 5 25,554,860 (GRCm39) missense probably benign 0.34
R9481:Kmt2c UTSW 5 25,497,907 (GRCm39) missense probably damaging 1.00
R9526:Kmt2c UTSW 5 25,486,355 (GRCm39) missense probably damaging 1.00
R9729:Kmt2c UTSW 5 25,489,758 (GRCm39) missense probably damaging 1.00
R9731:Kmt2c UTSW 5 25,577,956 (GRCm39) missense probably benign 0.18
R9784:Kmt2c UTSW 5 25,549,959 (GRCm39) missense probably damaging 1.00
RF001:Kmt2c UTSW 5 25,520,773 (GRCm39) small insertion probably benign
RF006:Kmt2c UTSW 5 25,520,770 (GRCm39) small insertion probably benign
RF011:Kmt2c UTSW 5 25,543,457 (GRCm39) missense probably damaging 1.00
RF041:Kmt2c UTSW 5 25,520,773 (GRCm39) small insertion probably benign
RF047:Kmt2c UTSW 5 25,520,758 (GRCm39) small insertion probably benign
RF051:Kmt2c UTSW 5 25,518,477 (GRCm39) unclassified probably benign
RF055:Kmt2c UTSW 5 25,520,770 (GRCm39) small insertion probably benign
RF059:Kmt2c UTSW 5 25,518,477 (GRCm39) unclassified probably benign
RF063:Kmt2c UTSW 5 25,520,762 (GRCm39) small insertion probably benign
X0024:Kmt2c UTSW 5 25,610,483 (GRCm39) missense probably benign 0.26
X0027:Kmt2c UTSW 5 25,535,885 (GRCm39) missense possibly damaging 0.90
Z1176:Kmt2c UTSW 5 25,559,411 (GRCm39) missense probably damaging 1.00
Z1177:Kmt2c UTSW 5 25,571,195 (GRCm39) critical splice acceptor site probably null
Z1177:Kmt2c UTSW 5 25,505,001 (GRCm39) missense probably benign 0.00
Z1177:Kmt2c UTSW 5 25,500,395 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCACTAATACAGCTCTTCGGC -3'
(R):5'- AGCATTCTCTGGCTTTCTTGAG -3'

Sequencing Primer
(F):5'- AGCTCTTCGGCTGCAGATG -3'
(R):5'- TTCTCTGGCTTTCTTGAGTAAATAC -3'
Posted On 2022-10-06