Incidental Mutation 'R9653:Abca13'
ID 727212
Institutional Source Beutler Lab
Gene Symbol Abca13
Ensembl Gene ENSMUSG00000004668
Gene Name ATP-binding cassette, sub-family A (ABC1), member 13
Synonyms A930002G16Rik
Accession Numbers

NCBI RefSeq: NM_178259.3; MGI:2388707

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9653 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 9191942-9684259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 9293741 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 1868 (P1868L)
Ref Sequence ENSEMBL: ENSMUSP00000040465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042740]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042740
AA Change: P1868L

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040465
Gene: ENSMUSG00000004668
AA Change: P1868L

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 358 379 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 1382 1393 N/A INTRINSIC
low complexity region 1721 1737 N/A INTRINSIC
low complexity region 1859 1872 N/A INTRINSIC
Pfam:ABC2_membrane_3 3288 3740 4.7e-21 PFAM
low complexity region 3796 3809 N/A INTRINSIC
AAA 3835 4019 8.08e-12 SMART
transmembrane domain 4206 4228 N/A INTRINSIC
Pfam:ABC2_membrane_3 4317 4646 1.6e-33 PFAM
AAA 4721 4909 8.86e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.[provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(3) : Targeted(3

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Adamtsl5 C T 10: 80,344,929 G100R probably damaging Het
Adgrg5 C T 8: 94,937,236 P235S Het
Anks1b T G 10: 90,510,662 L608R probably damaging Het
Ano10 C G 9: 122,251,155 A597P possibly damaging Het
Calb2 T C 8: 110,154,742 M58V probably benign Het
Ccdc180 T C 4: 45,923,495 I1092T probably damaging Het
Ces3b G T 8: 105,085,625 A169S probably damaging Het
Chmp2a A T 7: 13,032,529 F129I probably damaging Het
Clasp2 T A 9: 113,841,925 W365R probably benign Het
Col12a1 T C 9: 79,677,274 K1344R probably benign Het
Col3a1 A G 1: 45,321,568 I53V unknown Het
Coro2b T C 9: 62,427,977 Y309C probably damaging Het
Cramp1l C A 17: 24,982,809 K566N probably damaging Het
Crygs T A 16: 22,806,554 T46S probably benign Het
Ctbp2 C G 7: 133,014,204 R334P probably damaging Het
Dcstamp A T 15: 39,760,396 D469V probably benign Het
Dhdh T C 7: 45,479,127 D209G probably damaging Het
Dnah7b T C 1: 46,213,384 V1742A possibly damaging Het
Dnaja2 T C 8: 85,539,353 T368A probably benign Het
Dscaml1 T C 9: 45,732,168 probably null Het
Eps8l1 A T 7: 4,478,887 K704M unknown Het
Fam159b A G 13: 104,863,788 probably benign Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fgd4 T A 16: 16,436,597 H524L probably benign Het
Fktn T A 4: 53,731,273 F103I probably benign Het
Gcc2 T C 10: 58,275,000 M1001T possibly damaging Het
Gm4847 T C 1: 166,640,013 S205G possibly damaging Het
Grid2 A T 6: 63,930,984 N203Y possibly damaging Het
Hif3a G A 7: 17,048,716 A308V probably damaging Het
Htr5a A G 5: 27,842,840 N131S possibly damaging Het
Igfn1 G A 1: 135,955,585 Q2728* probably null Het
Ighv5-16 C A 12: 113,838,693 K62N possibly damaging Het
Ip6k3 A T 17: 27,148,614 Y203N possibly damaging Het
Itga2 G A 13: 114,884,455 P120L probably benign Het
Itpkb G T 1: 180,332,491 E61* probably null Het
Kcnj3 G A 2: 55,594,852 V321M probably damaging Het
Kmt2c A G 5: 25,302,821 L3206P probably damaging Het
Krtap5-4 T C 7: 142,304,171 C193R unknown Het
Large1 G T 8: 72,837,478 H553Q probably benign Het
Lrfn5 T A 12: 61,843,632 V569D probably damaging Het
Luzp2 A G 7: 55,052,832 T48A probably damaging Het
Lypd6 A T 2: 50,190,746 T149S probably benign Het
Map3k1 T C 13: 111,753,762 N1301S possibly damaging Het
Ndufv2 C T 17: 66,089,256 W91* probably null Het
Nisch A T 14: 31,171,671 V1315E probably damaging Het
Npas1 T C 7: 16,456,221 I467V probably benign Het
Nucb1 A G 7: 45,494,778 M337T probably benign Het
Olfr1315-ps1 A T 2: 112,110,916 M112K probably damaging Het
Olfr610 C T 7: 103,506,520 R142H probably benign Het
Olfr682-ps1 A T 7: 105,126,778 N164K probably benign Het
Olfr960 T C 9: 39,623,858 L243P probably damaging Het
Oog3 T G 4: 144,157,919 R482S probably benign Het
Padi2 T C 4: 140,934,725 probably null Het
Pam C T 1: 97,840,744 V660M possibly damaging Het
Phc2 C T 4: 128,747,219 L700F probably damaging Het
Plekha1 T C 7: 130,877,764 V4A possibly damaging Het
Rai1 A G 11: 60,189,316 E1402G probably benign Het
Recql5 G A 11: 115,897,206 A429V probably benign Het
Rere A G 4: 150,431,553 N101S probably benign Het
Robo1 T G 16: 73,024,442 S1357A possibly damaging Het
Rsl1 T A 13: 67,182,042 Y185N probably damaging Het
Rsph3a T C 17: 7,946,242 S145P possibly damaging Het
Sall1 T C 8: 89,030,878 E866G probably damaging Het
Sall3 A T 18: 80,973,013 S567T probably benign Het
Sap30 G A 8: 57,485,122 Q154* probably null Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Scn8a A G 15: 101,040,066 E1772G probably damaging Het
Scube3 C T 17: 28,156,798 A169V probably damaging Het
Sema6c T C 3: 95,173,214 S940P probably benign Het
Sertad4 C T 1: 192,846,528 D327N probably damaging Het
Skp1a A G 11: 52,243,687 T82A possibly damaging Het
Slc39a14 G T 14: 70,309,799 T366K probably damaging Het
Snrnp200 G T 2: 127,226,039 V819L probably damaging Het
Sntg1 T A 1: 8,363,525 T501S unknown Het
Srsf12 T C 4: 33,231,249 S253P possibly damaging Het
Sycp2l A G 13: 41,141,905 S315G probably benign Het
Tars2 T C 3: 95,748,067 Y337C probably damaging Het
Thbs4 T C 13: 92,761,514 D599G probably benign Het
Tmem200c A G 17: 68,842,186 H588R probably benign Het
Tmem255b T A 8: 13,456,005 V204E probably damaging Het
Usp24 T A 4: 106,347,367 M261K probably benign Het
Utrn T A 10: 12,621,379 I2429F probably benign Het
Utrn C T 10: 12,663,445 A1943T probably benign Het
Vmn2r85 A T 10: 130,425,825 D214E probably damaging Het
Wdr81 G T 11: 75,449,387 P183T Het
Zfp28 G A 7: 6,392,624 R134H Het
Zfp532 T A 18: 65,623,237 D80E possibly damaging Het
Zfyve26 T C 12: 79,287,644 D200G probably benign Het
Other mutations in Abca13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Abca13 APN 11 9297443 missense probably benign 0.24
IGL00481:Abca13 APN 11 9290969 missense probably damaging 0.99
IGL00707:Abca13 APN 11 9291586 missense probably damaging 0.99
IGL00755:Abca13 APN 11 9542102 missense possibly damaging 0.87
IGL00771:Abca13 APN 11 9290870 missense probably damaging 1.00
IGL00802:Abca13 APN 11 9297717 missense probably damaging 0.96
IGL00807:Abca13 APN 11 9378285 missense probably benign 0.10
IGL00977:Abca13 APN 11 9399284 missense probably damaging 1.00
IGL01064:Abca13 APN 11 9483855 missense probably benign 0.01
IGL01100:Abca13 APN 11 9274673 splice site probably null
IGL01290:Abca13 APN 11 9256232 missense probably damaging 1.00
IGL01299:Abca13 APN 11 9298743 missense probably benign 0.22
IGL01302:Abca13 APN 11 9399470 splice site probably benign
IGL01307:Abca13 APN 11 9297159 missense possibly damaging 0.86
IGL01349:Abca13 APN 11 9292076 missense probably benign 0.05
IGL01351:Abca13 APN 11 9267565 missense probably benign 0.28
IGL01446:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01453:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01461:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01476:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01506:Abca13 APN 11 9297447 missense probably benign 0.36
IGL01527:Abca13 APN 11 9290788 missense possibly damaging 0.49
IGL01559:Abca13 APN 11 9309020 missense possibly damaging 0.82
IGL01580:Abca13 APN 11 9293527 missense probably benign 0.00
IGL01679:Abca13 APN 11 9298071 missense probably benign 0.07
IGL01731:Abca13 APN 11 9249749 splice site probably benign
IGL01762:Abca13 APN 11 9315423 missense probably benign 0.18
IGL01781:Abca13 APN 11 9399280 missense probably damaging 1.00
IGL01802:Abca13 APN 11 9292438 missense probably benign 0.00
IGL01809:Abca13 APN 11 9290339 missense probably damaging 0.96
IGL01906:Abca13 APN 11 9216225 missense probably damaging 1.00
IGL01928:Abca13 APN 11 9683342 missense probably benign 0.13
IGL01940:Abca13 APN 11 9567661 splice site probably benign
IGL01993:Abca13 APN 11 9258452 unclassified probably benign
IGL02039:Abca13 APN 11 9297193 nonsense probably null
IGL02159:Abca13 APN 11 9314545 missense probably benign 0.00
IGL02202:Abca13 APN 11 9288529 missense possibly damaging 0.55
IGL02268:Abca13 APN 11 9290626 missense probably benign 0.00
IGL02332:Abca13 APN 11 9291482 missense probably damaging 0.98
IGL02380:Abca13 APN 11 9291599 missense possibly damaging 0.73
IGL02466:Abca13 APN 11 9297527 missense probably benign 0.00
IGL02505:Abca13 APN 11 9581498 missense probably damaging 1.00
IGL02507:Abca13 APN 11 9399388 missense probably damaging 1.00
IGL02558:Abca13 APN 11 9399387 missense probably damaging 1.00
IGL02581:Abca13 APN 11 9399132 splice site probably benign
IGL02586:Abca13 APN 11 9293983 missense possibly damaging 0.56
IGL02598:Abca13 APN 11 9431898 missense probably damaging 1.00
IGL02747:Abca13 APN 11 9373282 nonsense probably null
IGL02893:Abca13 APN 11 9290543 missense probably damaging 0.96
IGL02930:Abca13 APN 11 9378226 missense possibly damaging 0.86
IGL02967:Abca13 APN 11 9378291 missense probably damaging 0.99
IGL02983:Abca13 APN 11 9290663 missense probably benign 0.40
IGL02999:Abca13 APN 11 9581757 splice site probably benign
IGL03100:Abca13 APN 11 9258527 missense probably benign 0.25
IGL03114:Abca13 APN 11 9528999 missense probably benign 0.06
IGL03230:Abca13 APN 11 9294313 missense probably benign 0.02
IGL03329:Abca13 APN 11 9298047 missense probably benign 0.08
IGL03380:Abca13 APN 11 9298574 missense probably benign 0.10
IGL02835:Abca13 UTSW 11 9451515 missense probably damaging 1.00
PIT4366001:Abca13 UTSW 11 9294962 missense probably benign
PIT4458001:Abca13 UTSW 11 9298304 missense probably benign 0.05
R0017:Abca13 UTSW 11 9292775 missense probably damaging 0.99
R0079:Abca13 UTSW 11 9293493 missense probably benign 0.00
R0089:Abca13 UTSW 11 9292886 missense possibly damaging 0.76
R0103:Abca13 UTSW 11 9273951 missense probably damaging 1.00
R0103:Abca13 UTSW 11 9273951 missense probably damaging 1.00
R0113:Abca13 UTSW 11 9292114 missense possibly damaging 0.54
R0119:Abca13 UTSW 11 9298076 missense probably benign 0.03
R0152:Abca13 UTSW 11 9581724 missense probably damaging 0.98
R0255:Abca13 UTSW 11 9581545 missense probably damaging 1.00
R0277:Abca13 UTSW 11 9294701 missense probably benign 0.25
R0278:Abca13 UTSW 11 9378215 missense probably damaging 1.00
R0294:Abca13 UTSW 11 9269122 splice site probably null
R0299:Abca13 UTSW 11 9298076 missense probably benign 0.03
R0310:Abca13 UTSW 11 9293810 missense probably benign 0.36
R0317:Abca13 UTSW 11 9293459 missense probably damaging 1.00
R0323:Abca13 UTSW 11 9294701 missense probably benign 0.25
R0324:Abca13 UTSW 11 9297669 missense possibly damaging 0.76
R0329:Abca13 UTSW 11 9399430 missense probably damaging 0.97
R0336:Abca13 UTSW 11 9298481 missense probably benign 0.04
R0346:Abca13 UTSW 11 9566278 missense probably damaging 0.99
R0380:Abca13 UTSW 11 9588500 splice site probably null
R0382:Abca13 UTSW 11 9636650 splice site probably benign
R0482:Abca13 UTSW 11 9328207 missense possibly damaging 0.88
R0487:Abca13 UTSW 11 9331687 missense probably benign 0.07
R0491:Abca13 UTSW 11 9298235 missense probably benign 0.02
R0496:Abca13 UTSW 11 9291701 missense probably benign 0.01
R0505:Abca13 UTSW 11 9291058 missense probably benign 0.00
R0511:Abca13 UTSW 11 9294559 missense probably benign
R0525:Abca13 UTSW 11 9293371 missense probably damaging 1.00
R0538:Abca13 UTSW 11 9267622 critical splice donor site probably null
R0615:Abca13 UTSW 11 9256197 missense probably damaging 0.96
R0634:Abca13 UTSW 11 9314491 missense possibly damaging 0.59
R0699:Abca13 UTSW 11 9588508 splice site probably benign
R0848:Abca13 UTSW 11 9682011 nonsense probably null
R0883:Abca13 UTSW 11 9291238 nonsense probably null
R0892:Abca13 UTSW 11 9298305 missense probably benign 0.00
R0904:Abca13 UTSW 11 9298740 missense probably benign 0.22
R0968:Abca13 UTSW 11 9298016 missense probably benign 0.00
R1187:Abca13 UTSW 11 9528981 missense probably benign 0.00
R1299:Abca13 UTSW 11 9294821 missense possibly damaging 0.94
R1323:Abca13 UTSW 11 9290937 missense possibly damaging 0.86
R1323:Abca13 UTSW 11 9290937 missense possibly damaging 0.86
R1368:Abca13 UTSW 11 9291836 missense probably benign
R1387:Abca13 UTSW 11 9682085 nonsense probably null
R1436:Abca13 UTSW 11 9292646 missense probably damaging 0.99
R1449:Abca13 UTSW 11 9298580 missense probably damaging 1.00
R1450:Abca13 UTSW 11 9430531 splice site probably benign
R1462:Abca13 UTSW 11 9483924 splice site probably benign
R1465:Abca13 UTSW 11 9399303 missense probably damaging 1.00
R1465:Abca13 UTSW 11 9399303 missense probably damaging 1.00
R1466:Abca13 UTSW 11 9570536 splice site probably benign
R1494:Abca13 UTSW 11 9466429 nonsense probably null
R1559:Abca13 UTSW 11 9399180 missense probably null 1.00
R1564:Abca13 UTSW 11 9434316 nonsense probably null
R1698:Abca13 UTSW 11 9314507 missense probably benign 0.13
R1728:Abca13 UTSW 11 9249680 missense probably benign 0.02
R1734:Abca13 UTSW 11 9585460 missense probably benign 0.03
R1781:Abca13 UTSW 11 9269194 missense probably damaging 1.00
R1782:Abca13 UTSW 11 9297971 missense probably benign 0.36
R1807:Abca13 UTSW 11 9291755 missense probably damaging 0.98
R1830:Abca13 UTSW 11 9290350 missense probably benign 0.04
R1869:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1870:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1871:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1903:Abca13 UTSW 11 9466411 missense probably benign 0.13
R1916:Abca13 UTSW 11 9534456 missense probably damaging 1.00
R1936:Abca13 UTSW 11 9293595 missense probably benign 0.13
R1976:Abca13 UTSW 11 9397815 missense probably damaging 1.00
R2001:Abca13 UTSW 11 9273967 missense probably benign 0.01
R2007:Abca13 UTSW 11 9191987 missense probably benign 0.19
R2016:Abca13 UTSW 11 9290619 missense probably damaging 1.00
R2017:Abca13 UTSW 11 9290619 missense probably damaging 1.00
R2034:Abca13 UTSW 11 9292628 missense possibly damaging 0.83
R2051:Abca13 UTSW 11 9328098 missense probably benign 0.04
R2075:Abca13 UTSW 11 9522382 missense probably damaging 1.00
R2118:Abca13 UTSW 11 9309013 splice site probably benign
R2120:Abca13 UTSW 11 9309013 splice site probably benign
R2124:Abca13 UTSW 11 9309013 splice site probably benign
R2148:Abca13 UTSW 11 9615764 missense probably damaging 1.00
R2149:Abca13 UTSW 11 9267508 missense possibly damaging 0.68
R2157:Abca13 UTSW 11 9577170 missense probably damaging 0.97
R2167:Abca13 UTSW 11 9288532 missense probably benign 0.19
R2261:Abca13 UTSW 11 9292288 missense probably benign
R2263:Abca13 UTSW 11 9274702 missense probably benign 0.04
R2281:Abca13 UTSW 11 9328136 missense probably damaging 0.98
R2340:Abca13 UTSW 11 9399165 missense probably damaging 0.99
R2357:Abca13 UTSW 11 9297336 missense probably damaging 1.00
R2370:Abca13 UTSW 11 9256185 missense possibly damaging 0.85
R2384:Abca13 UTSW 11 9267450 splice site probably benign
R2393:Abca13 UTSW 11 9275057 nonsense probably null
R2432:Abca13 UTSW 11 9451333 splice site probably benign
R2446:Abca13 UTSW 11 9275101 missense probably benign
R2568:Abca13 UTSW 11 9333310 missense probably benign 0.40
R2847:Abca13 UTSW 11 9294584 missense possibly damaging 0.59
R2860:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2861:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2862:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2877:Abca13 UTSW 11 9291889 missense possibly damaging 0.91
R2878:Abca13 UTSW 11 9291889 missense possibly damaging 0.91
R3748:Abca13 UTSW 11 9316119 splice site probably benign
R3789:Abca13 UTSW 11 9510668 missense probably damaging 0.97
R3933:Abca13 UTSW 11 9354856 missense probably damaging 1.00
R3981:Abca13 UTSW 11 9532407 missense probably benign
R4002:Abca13 UTSW 11 9585415 missense probably benign 0.00
R4010:Abca13 UTSW 11 9622013 splice site probably benign
R4011:Abca13 UTSW 11 9622013 splice site probably benign
R4127:Abca13 UTSW 11 9191973 missense probably benign 0.00
R4214:Abca13 UTSW 11 9293877 missense probably damaging 0.96
R4236:Abca13 UTSW 11 9256205 missense probably damaging 1.00
R4237:Abca13 UTSW 11 9434188 missense probably benign 0.01
R4359:Abca13 UTSW 11 9297629 missense probably benign 0.02
R4378:Abca13 UTSW 11 9293644 missense probably benign 0.00
R4389:Abca13 UTSW 11 9297878 missense probably damaging 0.98
R4392:Abca13 UTSW 11 9309034 missense possibly damaging 0.94
R4623:Abca13 UTSW 11 9309130 missense probably damaging 1.00
R4684:Abca13 UTSW 11 9434193 nonsense probably null
R4691:Abca13 UTSW 11 9434195 missense probably damaging 1.00
R4700:Abca13 UTSW 11 9292306 missense possibly damaging 0.59
R4701:Abca13 UTSW 11 9292306 missense possibly damaging 0.59
R4704:Abca13 UTSW 11 9276990 missense possibly damaging 0.94
R4751:Abca13 UTSW 11 9277973 critical splice donor site probably null
R4772:Abca13 UTSW 11 9315339 splice site probably null
R4782:Abca13 UTSW 11 9328096 missense probably damaging 0.96
R4801:Abca13 UTSW 11 9522341 missense possibly damaging 0.94
R4802:Abca13 UTSW 11 9522341 missense possibly damaging 0.94
R4819:Abca13 UTSW 11 9290421 missense possibly damaging 0.88
R4831:Abca13 UTSW 11 9542077 nonsense probably null
R4851:Abca13 UTSW 11 9483890 missense probably benign 0.02
R4857:Abca13 UTSW 11 9294143 missense probably benign 0.22
R4869:Abca13 UTSW 11 9315434 splice site probably null
R4982:Abca13 UTSW 11 9292348 missense possibly damaging 0.58
R5031:Abca13 UTSW 11 9297678 missense probably damaging 0.99
R5044:Abca13 UTSW 11 9373323 missense possibly damaging 0.80
R5092:Abca13 UTSW 11 9258535 missense probably damaging 1.00
R5155:Abca13 UTSW 11 9532447 missense probably damaging 0.98
R5173:Abca13 UTSW 11 9682032 frame shift probably null
R5180:Abca13 UTSW 11 9466510 missense probably benign 0.01
R5244:Abca13 UTSW 11 9275081 missense probably benign 0.28
R5257:Abca13 UTSW 11 9249684 missense possibly damaging 0.94
R5258:Abca13 UTSW 11 9249684 missense possibly damaging 0.94
R5299:Abca13 UTSW 11 9431861 missense probably damaging 1.00
R5363:Abca13 UTSW 11 9277035 missense possibly damaging 0.75
R5365:Abca13 UTSW 11 9628629 missense probably damaging 1.00
R5419:Abca13 UTSW 11 9193533 critical splice donor site probably null
R5426:Abca13 UTSW 11 9290722 missense probably damaging 1.00
R5468:Abca13 UTSW 11 9294062 missense probably damaging 1.00
R5477:Abca13 UTSW 11 9301298 missense possibly damaging 0.49
R5541:Abca13 UTSW 11 9291545 missense probably benign 0.00
R5553:Abca13 UTSW 11 9328158 missense probably damaging 1.00
R5556:Abca13 UTSW 11 9258546 missense possibly damaging 0.91
R5566:Abca13 UTSW 11 9294615 nonsense probably null
R5582:Abca13 UTSW 11 9636639 splice site probably null
R5604:Abca13 UTSW 11 9566279 missense probably damaging 0.97
R5609:Abca13 UTSW 11 9403874 missense probably benign 0.01
R5617:Abca13 UTSW 11 9277891 missense probably benign 0.00
R5693:Abca13 UTSW 11 9316233 missense probably benign 0.29
R5707:Abca13 UTSW 11 9510620 missense probably damaging 1.00
R5725:Abca13 UTSW 11 9577181 missense probably benign 0.00
R5728:Abca13 UTSW 11 9570576 missense probably damaging 1.00
R5738:Abca13 UTSW 11 9621917 missense probably damaging 1.00
R5758:Abca13 UTSW 11 9314536 missense probably damaging 0.97
R5762:Abca13 UTSW 11 9581665 missense probably damaging 1.00
R5771:Abca13 UTSW 11 9291411 missense probably damaging 1.00
R5809:Abca13 UTSW 11 9293692 missense probably damaging 1.00
R5826:Abca13 UTSW 11 9682056 missense probably damaging 0.99
R5831:Abca13 UTSW 11 9567777 nonsense probably null
R5834:Abca13 UTSW 11 9277974 critical splice donor site probably null
R5902:Abca13 UTSW 11 9297177 missense probably damaging 1.00
R5933:Abca13 UTSW 11 9249658 missense possibly damaging 0.63
R5945:Abca13 UTSW 11 9293398 missense probably benign 0.04
R5969:Abca13 UTSW 11 9292214 nonsense probably null
R5985:Abca13 UTSW 11 9291628 missense probably benign 0.02
R5998:Abca13 UTSW 11 9567708 missense probably damaging 0.97
R6021:Abca13 UTSW 11 9290465 nonsense probably null
R6022:Abca13 UTSW 11 9290759 missense probably damaging 1.00
R6032:Abca13 UTSW 11 9297752 missense possibly damaging 0.52
R6032:Abca13 UTSW 11 9297752 missense possibly damaging 0.52
R6105:Abca13 UTSW 11 9397812 missense probably damaging 1.00
R6153:Abca13 UTSW 11 9301259 critical splice acceptor site probably null
R6162:Abca13 UTSW 11 9309047 missense probably damaging 1.00
R6187:Abca13 UTSW 11 9309085 missense probably damaging 1.00
R6247:Abca13 UTSW 11 9403874 missense probably benign 0.01
R6329:Abca13 UTSW 11 9277937 missense probably damaging 1.00
R6352:Abca13 UTSW 11 9309139 splice site probably null
R6367:Abca13 UTSW 11 9216248 missense possibly damaging 0.85
R6423:Abca13 UTSW 11 9298778 missense probably benign 0.01
R6424:Abca13 UTSW 11 9510542 missense probably benign
R6456:Abca13 UTSW 11 9290474 missense possibly damaging 0.94
R6490:Abca13 UTSW 11 9298661 missense probably benign 0.00
R6547:Abca13 UTSW 11 9274757 missense probably benign 0.04
R6594:Abca13 UTSW 11 9294632 missense possibly damaging 0.52
R6604:Abca13 UTSW 11 9378384 missense probably damaging 1.00
R6614:Abca13 UTSW 11 9294371 missense probably benign 0.04
R6736:Abca13 UTSW 11 9465058 missense probably damaging 1.00
R6742:Abca13 UTSW 11 9328168 missense probably damaging 1.00
R6791:Abca13 UTSW 11 9378504 missense probably damaging 1.00
R6834:Abca13 UTSW 11 9275110 missense possibly damaging 0.48
R6936:Abca13 UTSW 11 9298568 missense probably damaging 0.96
R6955:Abca13 UTSW 11 9294307 missense probably benign 0.28
R7031:Abca13 UTSW 11 9621892 missense probably damaging 1.00
R7065:Abca13 UTSW 11 9292595 missense probably benign 0.02
R7067:Abca13 UTSW 11 9291845 missense probably benign 0.14
R7070:Abca13 UTSW 11 9290701 missense probably benign 0.06
R7094:Abca13 UTSW 11 9298610 missense probably damaging 0.96
R7102:Abca13 UTSW 11 9335215 missense probably damaging 1.00
R7105:Abca13 UTSW 11 9397842 missense probably damaging 1.00
R7131:Abca13 UTSW 11 9291893 missense probably benign 0.37
R7155:Abca13 UTSW 11 9529010 missense probably benign
R7158:Abca13 UTSW 11 9273982 missense probably benign
R7212:Abca13 UTSW 11 9298854 missense probably benign 0.04
R7215:Abca13 UTSW 11 9288405 splice site probably null
R7228:Abca13 UTSW 11 9297653 missense probably benign
R7231:Abca13 UTSW 11 9294175 missense probably benign 0.25
R7247:Abca13 UTSW 11 9290732 missense probably benign 0.00
R7278:Abca13 UTSW 11 9291126 missense possibly damaging 0.56
R7299:Abca13 UTSW 11 9294649 missense probably damaging 0.98
R7304:Abca13 UTSW 11 9297203 missense probably benign
R7328:Abca13 UTSW 11 9291545 missense probably benign 0.14
R7374:Abca13 UTSW 11 9292136 missense possibly damaging 0.46
R7376:Abca13 UTSW 11 9291118 missense probably benign 0.00
R7384:Abca13 UTSW 11 9333257 missense probably damaging 1.00
R7395:Abca13 UTSW 11 9291658 missense probably benign 0.01
R7419:Abca13 UTSW 11 9276959 missense probably damaging 1.00
R7419:Abca13 UTSW 11 9297833 missense probably damaging 1.00
R7421:Abca13 UTSW 11 9510463 missense probably benign
R7458:Abca13 UTSW 11 9290777 missense possibly damaging 0.94
R7474:Abca13 UTSW 11 9328088 nonsense probably null
R7492:Abca13 UTSW 11 9293167 missense probably benign 0.08
R7660:Abca13 UTSW 11 9290678 missense probably benign 0.00
R7677:Abca13 UTSW 11 9298349 nonsense probably null
R7744:Abca13 UTSW 11 9290421 missense possibly damaging 0.88
R7790:Abca13 UTSW 11 9297915 missense probably damaging 1.00
R7798:Abca13 UTSW 11 9291664 missense probably benign 0.04
R7811:Abca13 UTSW 11 9577141 splice site probably null
R7831:Abca13 UTSW 11 9297404 missense possibly damaging 0.46
R7867:Abca13 UTSW 11 9262139 critical splice donor site probably null
R7910:Abca13 UTSW 11 9581590 missense probably damaging 1.00
R7964:Abca13 UTSW 11 9316146 missense probably benign 0.06
R8037:Abca13 UTSW 11 9293904 missense probably damaging 1.00
R8049:Abca13 UTSW 11 9291867 missense probably damaging 0.99
R8059:Abca13 UTSW 11 9373279 missense probably benign 0.00
R8072:Abca13 UTSW 11 9294574 missense probably benign 0.10
R8078:Abca13 UTSW 11 9301279 missense probably benign 0.32
R8112:Abca13 UTSW 11 9314624 missense probably benign 0.01
R8146:Abca13 UTSW 11 9397829 missense probably damaging 1.00
R8164:Abca13 UTSW 11 9615799 missense probably damaging 1.00
R8195:Abca13 UTSW 11 9274735 missense probably benign 0.00
R8220:Abca13 UTSW 11 9434299 missense possibly damaging 0.58
R8235:Abca13 UTSW 11 9262077 missense probably damaging 0.99
R8307:Abca13 UTSW 11 9277922 nonsense probably null
R8310:Abca13 UTSW 11 9378269 missense possibly damaging 0.90
R8315:Abca13 UTSW 11 9378460 missense probably null 1.00
R8315:Abca13 UTSW 11 9585502 missense probably benign 0.44
R8324:Abca13 UTSW 11 9290395 missense probably damaging 1.00
R8375:Abca13 UTSW 11 9315416 missense probably benign 0.00
R8375:Abca13 UTSW 11 9397841 missense probably damaging 1.00
R8400:Abca13 UTSW 11 9293925 missense probably benign 0.00
R8400:Abca13 UTSW 11 9298218 missense probably damaging 0.97
R8425:Abca13 UTSW 11 9314623 missense possibly damaging 0.92
R8486:Abca13 UTSW 11 9275092 missense probably benign 0.00
R8493:Abca13 UTSW 11 9510668 missense probably damaging 0.97
R8502:Abca13 UTSW 11 9269282 missense probably benign 0.02
R8716:Abca13 UTSW 11 9293774 missense probably benign 0.09
R8787:Abca13 UTSW 11 9275053 missense possibly damaging 0.92
R8829:Abca13 UTSW 11 9621881 missense probably damaging 1.00
R8859:Abca13 UTSW 11 9378397 missense
R8871:Abca13 UTSW 11 9298071 missense probably benign 0.07
R8883:Abca13 UTSW 11 9333168 missense probably benign 0.00
R8919:Abca13 UTSW 11 9291653 missense possibly damaging 0.84
R8966:Abca13 UTSW 11 9628588 missense probably damaging 1.00
R8967:Abca13 UTSW 11 9292696 missense probably benign 0.18
R8969:Abca13 UTSW 11 9277944 missense probably benign
R8972:Abca13 UTSW 11 9328138 missense probably damaging 1.00
R9002:Abca13 UTSW 11 9291926 missense possibly damaging 0.94
R9046:Abca13 UTSW 11 9293525 missense probably benign 0.04
R9051:Abca13 UTSW 11 9335232 missense probably damaging 1.00
R9056:Abca13 UTSW 11 9464921 missense probably damaging 1.00
R9061:Abca13 UTSW 11 9277847 missense probably benign 0.02
R9072:Abca13 UTSW 11 9290834 missense possibly damaging 0.93
R9090:Abca13 UTSW 11 9291698 missense probably damaging 0.98
R9127:Abca13 UTSW 11 9292080 missense probably benign 0.03
R9164:Abca13 UTSW 11 9328157 missense probably damaging 1.00
R9175:Abca13 UTSW 11 9581593 missense probably damaging 0.98
R9190:Abca13 UTSW 11 9291886 missense probably damaging 0.96
R9244:Abca13 UTSW 11 9291577 missense probably benign 0.01
R9255:Abca13 UTSW 11 9328213 missense probably damaging 1.00
R9271:Abca13 UTSW 11 9291698 missense probably damaging 0.98
R9321:Abca13 UTSW 11 9510475 missense probably benign 0.00
R9356:Abca13 UTSW 11 9256305 missense probably benign 0.11
R9369:Abca13 UTSW 11 9378444 missense probably damaging 1.00
R9423:Abca13 UTSW 11 9290395 missense probably damaging 1.00
R9432:Abca13 UTSW 11 9294559 missense probably benign 0.00
R9455:Abca13 UTSW 11 9403897 missense probably damaging 1.00
R9486:Abca13 UTSW 11 9290621 missense possibly damaging 0.88
R9492:Abca13 UTSW 11 9293667 nonsense probably null
R9511:Abca13 UTSW 11 9328130 missense probably benign 0.16
R9545:Abca13 UTSW 11 9466538 missense probably damaging 1.00
R9566:Abca13 UTSW 11 9464927 missense probably damaging 1.00
R9609:Abca13 UTSW 11 9258549 missense probably damaging 1.00
R9616:Abca13 UTSW 11 9290501 missense probably benign 0.00
R9651:Abca13 UTSW 11 9293741 missense probably benign 0.31
R9651:Abca13 UTSW 11 9585484 missense probably benign
R9657:Abca13 UTSW 11 9293379 missense probably benign 0.35
R9684:Abca13 UTSW 11 9333307 missense probably damaging 1.00
X0013:Abca13 UTSW 11 9273899 missense probably benign 0.02
X0057:Abca13 UTSW 11 9294744 missense probably damaging 0.96
X0066:Abca13 UTSW 11 9267565 missense probably damaging 0.96
Z1088:Abca13 UTSW 11 9294687 missense probably damaging 0.99
Z1176:Abca13 UTSW 11 9251376 missense possibly damaging 0.88
Z1176:Abca13 UTSW 11 9267461 missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9294342 missense probably benign 0.01
Z1176:Abca13 UTSW 11 9335181 missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9335182 missense probably damaging 1.00
Z1177:Abca13 UTSW 11 9314545 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATGAGCCAGCTATTGTTCCAG -3'
(R):5'- CTGGGATGCTGCCATTACCTTG -3'

Sequencing Primer
(F):5'- CAGAAGCTTTGATGTGCCTTACCAG -3'
(R):5'- TGAAGAGCAGTACCTTATGCC -3'
Posted On 2022-10-06