Incidental Mutation 'R9654:Map6'
ID 727265
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms F-STOP, Mtap6, 2810411E12Rik, STOP
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock # R9654 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 99267447-99337137 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99336959 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 893 (I893T)
Ref Sequence ENSEMBL: ENSMUSP00000064787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: I893T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: I893T

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000122101
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: I893T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect probably damaging
Transcript: ENSMUST00000208924
AA Change: I690T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 82,064,715 S938P possibly damaging Het
Abca17 G T 17: 24,317,125 H523N probably benign Het
Alx1 T A 10: 103,022,232 H202L probably benign Het
Amotl1 T A 9: 14,551,685 H744L probably benign Het
Ankrd50 A T 3: 38,456,869 S450T probably benign Het
Arhgef25 C T 10: 127,186,086 S200N probably damaging Het
Arl4c G T 1: 88,701,639 S9* probably null Het
Bod1l A G 5: 41,818,364 M1869T probably benign Het
Btnl6 G A 17: 34,514,166 P241L probably damaging Het
Cacng8 C T 7: 3,394,486 R88W probably damaging Het
Ccdc154 C T 17: 25,167,710 T262I possibly damaging Het
Clmn C A 12: 104,781,934 E451D probably damaging Het
Dnah14 A T 1: 181,766,339 I3416L probably benign Het
Dnah17 A G 11: 118,036,330 probably null Het
Dnah3 T A 7: 120,042,173 K1175* probably null Het
Dock8 C T 19: 25,147,346 R1009W probably damaging Het
Doxl2 T C 6: 48,975,903 L254P probably damaging Het
Fam160a1 G T 3: 85,672,225 T891K probably damaging Het
Fkbp15 A G 4: 62,312,316 V720A probably benign Het
Fryl G T 5: 73,118,458 P121Q probably benign Het
H2-Q6 C T 17: 35,425,209 R56C probably damaging Het
Hbs1l T C 10: 21,307,705 V115A possibly damaging Het
Heatr5a G A 12: 51,958,995 P66S probably damaging Het
Hsd17b4 A G 18: 50,139,466 D44G probably benign Het
Idh3a T C 9: 54,589,898 V41A probably benign Het
Itih1 T A 14: 30,942,913 K37M probably damaging Het
Lama1 A G 17: 67,794,271 T1920A Het
Ltn1 G C 16: 87,410,339 D904E probably benign Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mr1 T C 1: 155,137,684 H49R possibly damaging Het
Myh2 T C 11: 67,197,345 V1929A probably benign Het
Ncoa4 C A 14: 32,174,508 P230Q probably benign Het
Npy4r T A 14: 34,147,124 Q69L probably damaging Het
Nup210l C T 3: 90,199,866 P1570L probably benign Het
Nus1 T G 10: 52,418,034 L98R possibly damaging Het
Olfr1117-ps1 C T 2: 87,284,727 L146F probably benign Het
Olfr1201 T C 2: 88,794,919 L179S probably damaging Het
Olfr1362 T C 13: 21,611,745 T75A possibly damaging Het
Olfr181 T A 16: 58,926,389 I61F probably benign Het
Olfr296-ps1 T A 7: 86,561,742 N3K unknown Het
Pcdha11 A C 18: 37,012,280 T475P probably damaging Het
Pex5l C A 3: 32,956,678 A384S probably benign Het
Pgk2 T A 17: 40,207,760 D259V probably damaging Het
Rhbdf1 T C 11: 32,216,028 M52V probably benign Het
Rsph6a T A 7: 19,065,407 L321Q probably damaging Het
Sugp1 T A 8: 70,070,006 M452K probably damaging Het
Sult2a6 T G 7: 14,222,520 D272A probably benign Het
Tlr6 A T 5: 64,955,354 L70Q probably damaging Het
Tmem178b A T 6: 40,245,600 Y83F probably benign Het
Tmprss4 C T 9: 45,179,402 probably null Het
Trpv4 A G 5: 114,626,826 L709P probably benign Het
Utp15 G A 13: 98,249,160 T519M probably benign Het
Vmn2r59 T C 7: 42,043,793 N461S probably benign Het
Zap70 T C 1: 36,779,246 V338A probably benign Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0118:Map6 UTSW 7 99317617 missense possibly damaging 0.53
R0125:Map6 UTSW 7 99335980 splice site probably null
R0244:Map6 UTSW 7 99336836 missense probably benign 0.00
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0974:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R1455:Map6 UTSW 7 99268214 missense probably damaging 1.00
R1678:Map6 UTSW 7 99268098 missense probably damaging 1.00
R1696:Map6 UTSW 7 99317457 splice site probably null
R1866:Map6 UTSW 7 99315876 missense probably damaging 1.00
R2061:Map6 UTSW 7 99317472 missense probably damaging 1.00
R3236:Map6 UTSW 7 99336824 missense probably damaging 1.00
R3625:Map6 UTSW 7 99269195 missense possibly damaging 0.60
R4044:Map6 UTSW 7 99268049 missense probably damaging 1.00
R4570:Map6 UTSW 7 99336556 missense possibly damaging 0.49
R5056:Map6 UTSW 7 99336652 missense probably benign 0.05
R5065:Map6 UTSW 7 99336710 missense probably benign 0.02
R5656:Map6 UTSW 7 99336298 missense probably damaging 1.00
R6101:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6105:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6302:Map6 UTSW 7 99336107 missense probably damaging 0.99
R6450:Map6 UTSW 7 99268038 missense probably damaging 1.00
R6915:Map6 UTSW 7 99268247 missense probably damaging 1.00
R7205:Map6 UTSW 7 99269050 missense probably benign 0.00
R7223:Map6 UTSW 7 99268025 missense probably damaging 1.00
R7293:Map6 UTSW 7 99336533 missense possibly damaging 0.49
R7481:Map6 UTSW 7 99269138 missense possibly damaging 0.57
R7489:Map6 UTSW 7 99268061 missense probably damaging 1.00
R7691:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7693:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7695:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R8341:Map6 UTSW 7 99268440 missense possibly damaging 0.75
R8865:Map6 UTSW 7 99268985 missense probably benign 0.37
R8953:Map6 UTSW 7 99315871 missense probably damaging 1.00
R9108:Map6 UTSW 7 99336896 missense probably damaging 1.00
R9173:Map6 UTSW 7 99268728 missense probably damaging 1.00
R9613:Map6 UTSW 7 99269177 missense possibly damaging 0.90
Z1176:Map6 UTSW 7 99317660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGCCTATAAAGAATCAAGACC -3'
(R):5'- TCACCCACTCAGTGTGCATG -3'

Sequencing Primer
(F):5'- AGACCCTATAATCCCAGTACCTTTG -3'
(R):5'- ACCCACTCAGTGTGCATGGTATG -3'
Posted On 2022-10-06