Incidental Mutation 'R9654:Map6'
ID 727265
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.150) question?
Stock # R9654 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98986166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 893 (I893T)
Ref Sequence ENSEMBL: ENSMUSP00000064787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: I893T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: I893T

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000122101
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: I893T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect probably damaging
Transcript: ENSMUST00000208924
AA Change: I690T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 81,948,916 (GRCm39) S938P possibly damaging Het
Abca17 G T 17: 24,536,099 (GRCm39) H523N probably benign Het
Alx1 T A 10: 102,858,093 (GRCm39) H202L probably benign Het
Amotl1 T A 9: 14,462,981 (GRCm39) H744L probably benign Het
Ankrd50 A T 3: 38,511,018 (GRCm39) S450T probably benign Het
Aoc1l1 T C 6: 48,952,837 (GRCm39) L254P probably damaging Het
Arhgef25 C T 10: 127,021,955 (GRCm39) S200N probably damaging Het
Arl4c G T 1: 88,629,361 (GRCm39) S9* probably null Het
Bod1l A G 5: 41,975,707 (GRCm39) M1869T probably benign Het
Btnl6 G A 17: 34,733,140 (GRCm39) P241L probably damaging Het
Cacng8 C T 7: 3,443,002 (GRCm39) R88W probably damaging Het
Ccdc154 C T 17: 25,386,684 (GRCm39) T262I possibly damaging Het
Clmn C A 12: 104,748,193 (GRCm39) E451D probably damaging Het
Dnah14 A T 1: 181,593,904 (GRCm39) I3416L probably benign Het
Dnah17 A G 11: 117,927,156 (GRCm39) probably null Het
Dnah3 T A 7: 119,641,396 (GRCm39) K1175* probably null Het
Dock8 C T 19: 25,124,710 (GRCm39) R1009W probably damaging Het
Fhip1a G T 3: 85,579,532 (GRCm39) T891K probably damaging Het
Fkbp15 A G 4: 62,230,553 (GRCm39) V720A probably benign Het
Fryl G T 5: 73,275,801 (GRCm39) P121Q probably benign Het
H2-Q6 C T 17: 35,644,185 (GRCm39) R56C probably damaging Het
Hbs1l T C 10: 21,183,604 (GRCm39) V115A possibly damaging Het
Heatr5a G A 12: 52,005,778 (GRCm39) P66S probably damaging Het
Hsd17b4 A G 18: 50,272,533 (GRCm39) D44G probably benign Het
Idh3a T C 9: 54,497,182 (GRCm39) V41A probably benign Het
Itih1 T A 14: 30,664,870 (GRCm39) K37M probably damaging Het
Lama1 A G 17: 68,101,266 (GRCm39) T1920A Het
Ltn1 G C 16: 87,207,227 (GRCm39) D904E probably benign Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mr1 T C 1: 155,013,430 (GRCm39) H49R possibly damaging Het
Myh2 T C 11: 67,088,171 (GRCm39) V1929A probably benign Het
Ncoa4 C A 14: 31,896,465 (GRCm39) P230Q probably benign Het
Npy4r T A 14: 33,869,081 (GRCm39) Q69L probably damaging Het
Nup210l C T 3: 90,107,173 (GRCm39) P1570L probably benign Het
Nus1 T G 10: 52,294,130 (GRCm39) L98R possibly damaging Het
Or10ag55-ps1 C T 2: 87,115,071 (GRCm39) L146F probably benign Het
Or14c42-ps1 T A 7: 86,210,950 (GRCm39) N3K unknown Het
Or2w4 T C 13: 21,795,915 (GRCm39) T75A possibly damaging Het
Or4c11b T C 2: 88,625,263 (GRCm39) L179S probably damaging Het
Or5k17 T A 16: 58,746,752 (GRCm39) I61F probably benign Het
Pcdha11 A C 18: 37,145,333 (GRCm39) T475P probably damaging Het
Pex5l C A 3: 33,010,827 (GRCm39) A384S probably benign Het
Pgk2 T A 17: 40,518,651 (GRCm39) D259V probably damaging Het
Rhbdf1 T C 11: 32,166,028 (GRCm39) M52V probably benign Het
Rsph6a T A 7: 18,799,332 (GRCm39) L321Q probably damaging Het
Sugp1 T A 8: 70,522,656 (GRCm39) M452K probably damaging Het
Sult2a6 T G 7: 13,956,445 (GRCm39) D272A probably benign Het
Tlr6 A T 5: 65,112,697 (GRCm39) L70Q probably damaging Het
Tmem178b A T 6: 40,222,534 (GRCm39) Y83F probably benign Het
Tmprss4 C T 9: 45,090,700 (GRCm39) probably null Het
Trpv4 A G 5: 114,764,887 (GRCm39) L709P probably benign Het
Utp15 G A 13: 98,385,668 (GRCm39) T519M probably benign Het
Vmn2r59 T C 7: 41,693,217 (GRCm39) N461S probably benign Het
Zap70 T C 1: 36,818,327 (GRCm39) V338A probably benign Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0125:Map6 UTSW 7 98,985,187 (GRCm39) splice site probably null
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1455:Map6 UTSW 7 98,917,421 (GRCm39) missense probably damaging 1.00
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R1866:Map6 UTSW 7 98,965,083 (GRCm39) missense probably damaging 1.00
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4044:Map6 UTSW 7 98,917,256 (GRCm39) missense probably damaging 1.00
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5065:Map6 UTSW 7 98,985,917 (GRCm39) missense probably benign 0.02
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6101:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6302:Map6 UTSW 7 98,985,314 (GRCm39) missense probably damaging 0.99
R6450:Map6 UTSW 7 98,917,245 (GRCm39) missense probably damaging 1.00
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7205:Map6 UTSW 7 98,918,257 (GRCm39) missense probably benign 0.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7693:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7695:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R8953:Map6 UTSW 7 98,965,078 (GRCm39) missense probably damaging 1.00
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9173:Map6 UTSW 7 98,917,935 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGCCTATAAAGAATCAAGACC -3'
(R):5'- TCACCCACTCAGTGTGCATG -3'

Sequencing Primer
(F):5'- AGACCCTATAATCCCAGTACCTTTG -3'
(R):5'- ACCCACTCAGTGTGCATGGTATG -3'
Posted On 2022-10-06