Incidental Mutation 'R9656:Fam83b'
ID 727331
Institutional Source Beutler Lab
Gene Symbol Fam83b
Ensembl Gene ENSMUSG00000032358
Gene Name family with sequence similarity 83, member B
Synonyms C530008M07Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R9656 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 76397336-76474398 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76452863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 68 (V68A)
Ref Sequence ENSEMBL: ENSMUSP00000096146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098546] [ENSMUST00000183437]
AlphaFold Q0VBM2
Predicted Effect probably benign
Transcript: ENSMUST00000098546
AA Change: V68A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000096146
Gene: ENSMUSG00000032358
AA Change: V68A

DomainStartEndE-ValueType
Pfam:DUF1669 12 282 5.6e-109 PFAM
Pfam:PLDc_2 139 277 2.4e-12 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183437
AA Change: V68A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000139354
Gene: ENSMUSG00000032358
AA Change: V68A

DomainStartEndE-ValueType
Pfam:DUF1669 7 283 2.8e-111 PFAM
Pfam:PLDc_2 139 277 2.4e-9 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 G A 8: 10,037,991 (GRCm39) G196E possibly damaging Het
Atad5 G T 11: 79,980,542 (GRCm39) probably benign Het
Atxn2 C T 5: 121,922,061 (GRCm39) T635I possibly damaging Het
Bbs10 T A 10: 111,135,545 (GRCm39) N219K probably benign Het
Bsn T A 9: 107,994,407 (GRCm39) T623S probably benign Het
Btnl9 T C 11: 49,060,008 (GRCm39) D580G probably damaging Het
Cckar A G 5: 53,857,318 (GRCm39) L364P probably damaging Het
Ccn5 A G 2: 163,670,985 (GRCm39) D164G probably benign Het
Cfap46 A T 7: 139,235,816 (GRCm39) M631K Het
Col1a1 T A 11: 94,839,372 (GRCm39) S1006T unknown Het
Cpe T C 8: 65,047,980 (GRCm39) Y428C probably damaging Het
Cyp2d26 C A 15: 82,677,059 (GRCm39) V122L probably benign Het
Fam114a1 T C 5: 65,163,246 (GRCm39) I181T probably benign Het
Fanca A C 8: 124,031,482 (GRCm39) V403G probably benign Het
Grin2a T C 16: 9,397,471 (GRCm39) H872R possibly damaging Het
Grpel2 G T 18: 61,859,361 (GRCm39) R4S probably benign Het
Gstm1 T C 3: 107,925,072 (GRCm39) Y7C probably damaging Het
Hace1 A T 10: 45,547,545 (GRCm39) I497F probably benign Het
Hspg2 T C 4: 137,279,196 (GRCm39) V3093A probably benign Het
Ighv3-4 A T 12: 114,217,295 (GRCm39) F99I possibly damaging Het
Ints3 T C 3: 90,299,839 (GRCm39) M963V probably null Het
Krt12 T C 11: 99,309,471 (GRCm39) E263G Het
L1td1 T C 4: 98,622,223 (GRCm39) F262L probably benign Het
Lrp2bp A G 8: 46,466,158 (GRCm39) H110R probably benign Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Ncoa6 A G 2: 155,274,846 (GRCm39) I135T probably damaging Het
Nfatc3 G A 8: 106,830,766 (GRCm39) R695H probably damaging Het
Nkx1-2 T A 7: 132,201,228 (GRCm39) K10* probably null Het
Or2t44 G A 11: 58,677,635 (GRCm39) A192T possibly damaging Het
Or4f54 A T 2: 111,122,633 (GRCm39) T7S probably benign Het
Or5b110-ps1 T C 19: 13,260,035 (GRCm39) H129R possibly damaging Het
Or5b21 A G 19: 12,839,247 (GRCm39) Y36C probably damaging Het
Otog A G 7: 45,959,567 (GRCm39) T719A probably damaging Het
Prkdc T G 16: 15,617,818 (GRCm39) I3216M probably benign Het
Pygm A G 19: 6,438,187 (GRCm39) D252G probably benign Het
Rae1 T A 2: 172,854,590 (GRCm39) Y332* probably null Het
Rbm12 A T 2: 155,940,121 (GRCm39) D50E unknown Het
Rbm6 G A 9: 107,656,778 (GRCm39) R1000W probably damaging Het
Rd3l A T 12: 111,946,614 (GRCm39) V54E possibly damaging Het
Rft1 T C 14: 30,404,714 (GRCm39) V370A probably benign Het
Rfx8 T C 1: 39,709,679 (GRCm39) I449M probably benign Het
Satb1 A T 17: 52,112,264 (GRCm39) S117T possibly damaging Het
Slc24a2 T C 4: 86,968,144 (GRCm39) Y370C probably damaging Het
Slc5a4b C A 10: 75,944,391 (GRCm39) V85L probably damaging Het
Snrpn A T 7: 59,635,715 (GRCm39) V95E possibly damaging Het
Spata31e5 G T 1: 28,816,536 (GRCm39) H499N probably benign Het
Spata33 A T 8: 123,948,758 (GRCm39) N130I possibly damaging Het
Spmip2 T A 3: 79,313,183 (GRCm39) F86I probably benign Het
Tap1 A G 17: 34,412,525 (GRCm39) S521G probably damaging Het
Tbc1d13 C T 2: 30,032,429 (GRCm39) T180I possibly damaging Het
Tgm7 G A 2: 120,940,191 (GRCm39) probably benign Het
Tiam1 A G 16: 89,664,459 (GRCm39) M583T probably damaging Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Vmn1r43 A T 6: 89,847,440 (GRCm39) H15Q possibly damaging Het
Zfp329 A T 7: 12,544,417 (GRCm39) V369E probably damaging Het
Zfp467 T A 6: 48,419,603 (GRCm39) E35V possibly damaging Het
Other mutations in Fam83b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fam83b APN 9 76,398,260 (GRCm39) missense probably benign 0.00
IGL01554:Fam83b APN 9 76,409,403 (GRCm39) missense probably benign 0.33
IGL01694:Fam83b APN 9 76,398,272 (GRCm39) missense probably benign 0.13
IGL02009:Fam83b APN 9 76,399,604 (GRCm39) missense probably damaging 1.00
IGL02531:Fam83b APN 9 76,399,282 (GRCm39) missense possibly damaging 0.61
IGL03328:Fam83b APN 9 76,400,324 (GRCm39) missense probably benign 0.01
PIT4581001:Fam83b UTSW 9 76,398,434 (GRCm39) missense probably damaging 1.00
R0110:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0469:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0510:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0732:Fam83b UTSW 9 76,400,210 (GRCm39) nonsense probably null
R0946:Fam83b UTSW 9 76,398,679 (GRCm39) missense probably damaging 0.96
R0961:Fam83b UTSW 9 76,398,577 (GRCm39) missense probably damaging 0.97
R1101:Fam83b UTSW 9 76,452,952 (GRCm39) missense possibly damaging 0.68
R1200:Fam83b UTSW 9 76,399,594 (GRCm39) missense probably damaging 1.00
R1248:Fam83b UTSW 9 76,410,358 (GRCm39) missense probably benign 0.35
R1420:Fam83b UTSW 9 76,399,894 (GRCm39) missense possibly damaging 0.94
R1429:Fam83b UTSW 9 76,399,859 (GRCm39) missense probably benign
R1939:Fam83b UTSW 9 76,400,362 (GRCm39) missense probably damaging 1.00
R1992:Fam83b UTSW 9 76,399,304 (GRCm39) missense probably benign
R2102:Fam83b UTSW 9 76,399,987 (GRCm39) missense probably damaging 0.96
R2134:Fam83b UTSW 9 76,398,298 (GRCm39) missense probably damaging 1.00
R2398:Fam83b UTSW 9 76,409,500 (GRCm39) missense probably damaging 1.00
R2878:Fam83b UTSW 9 76,398,092 (GRCm39) missense probably damaging 1.00
R4092:Fam83b UTSW 9 76,398,943 (GRCm39) missense probably benign 0.24
R4204:Fam83b UTSW 9 76,410,335 (GRCm39) missense probably benign 0.09
R4537:Fam83b UTSW 9 76,399,424 (GRCm39) missense probably benign 0.10
R4920:Fam83b UTSW 9 76,399,150 (GRCm39) missense probably benign
R5456:Fam83b UTSW 9 76,399,877 (GRCm39) missense probably benign
R5473:Fam83b UTSW 9 76,398,782 (GRCm39) missense probably damaging 1.00
R5488:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5489:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5876:Fam83b UTSW 9 76,399,132 (GRCm39) missense possibly damaging 0.92
R6150:Fam83b UTSW 9 76,399,639 (GRCm39) missense probably damaging 1.00
R6374:Fam83b UTSW 9 76,400,189 (GRCm39) missense probably benign 0.31
R6468:Fam83b UTSW 9 76,409,413 (GRCm39) nonsense probably null
R6912:Fam83b UTSW 9 76,398,214 (GRCm39) missense probably damaging 0.99
R7022:Fam83b UTSW 9 76,409,394 (GRCm39) frame shift probably null
R7073:Fam83b UTSW 9 76,453,031 (GRCm39) missense probably benign 0.18
R7356:Fam83b UTSW 9 76,400,135 (GRCm39) missense probably benign 0.05
R7665:Fam83b UTSW 9 76,398,157 (GRCm39) missense probably damaging 1.00
R7762:Fam83b UTSW 9 76,399,714 (GRCm39) missense possibly damaging 0.87
R7790:Fam83b UTSW 9 76,399,330 (GRCm39) missense probably benign 0.01
R7869:Fam83b UTSW 9 76,399,426 (GRCm39) missense possibly damaging 0.78
R7879:Fam83b UTSW 9 76,399,737 (GRCm39) missense possibly damaging 0.76
R7957:Fam83b UTSW 9 76,399,267 (GRCm39) missense probably benign 0.00
R8067:Fam83b UTSW 9 76,398,380 (GRCm39) missense probably benign
R8983:Fam83b UTSW 9 76,400,357 (GRCm39) missense probably damaging 1.00
R9361:Fam83b UTSW 9 76,400,076 (GRCm39) missense probably benign 0.03
R9405:Fam83b UTSW 9 76,398,703 (GRCm39) missense possibly damaging 0.93
R9475:Fam83b UTSW 9 76,399,085 (GRCm39) missense probably benign 0.31
R9690:Fam83b UTSW 9 76,398,502 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGAGGTCTATGTGGGTACTCC -3'
(R):5'- TTGAAAGTTCCCCTCATCCAAC -3'

Sequencing Primer
(F):5'- CCTAAGAGTCCGGGCATCAC -3'
(R):5'- CATGGAGGCTTCATCAATGC -3'
Posted On 2022-10-06