Incidental Mutation 'R9656:Fam83b'
ID 727331
Institutional Source Beutler Lab
Gene Symbol Fam83b
Ensembl Gene ENSMUSG00000032358
Gene Name family with sequence similarity 83, member B
Synonyms C530008M07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R9656 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 76490054-76567116 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76545581 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 68 (V68A)
Ref Sequence ENSEMBL: ENSMUSP00000096146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098546] [ENSMUST00000183437]
AlphaFold Q0VBM2
Predicted Effect probably benign
Transcript: ENSMUST00000098546
AA Change: V68A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000096146
Gene: ENSMUSG00000032358
AA Change: V68A

DomainStartEndE-ValueType
Pfam:DUF1669 12 282 5.6e-109 PFAM
Pfam:PLDc_2 139 277 2.4e-12 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183437
AA Change: V68A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000139354
Gene: ENSMUSG00000032358
AA Change: V68A

DomainStartEndE-ValueType
Pfam:DUF1669 7 283 2.8e-111 PFAM
Pfam:PLDc_2 139 277 2.4e-9 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 G A 8: 9,987,991 G196E possibly damaging Het
Atad5 G T 11: 80,089,716 probably benign Het
Atxn2 C T 5: 121,783,998 T635I possibly damaging Het
Bbs10 T A 10: 111,299,684 N219K probably benign Het
Bsn T A 9: 108,117,208 T623S probably benign Het
Btnl9 T C 11: 49,169,181 D580G probably damaging Het
Cckar A G 5: 53,699,976 L364P probably damaging Het
Cfap46 A T 7: 139,655,900 M631K Het
Col1a1 T A 11: 94,948,546 S1006T unknown Het
Cpe T C 8: 64,594,946 Y428C probably damaging Het
Cyp2d26 C A 15: 82,792,858 V122L probably benign Het
Fam114a1 T C 5: 65,005,903 I181T probably benign Het
Fanca A C 8: 123,304,743 V403G probably benign Het
Gm17359 T A 3: 79,405,876 F86I probably benign Het
Gm597 G T 1: 28,777,455 H499N probably benign Het
Grin2a T C 16: 9,579,607 H872R possibly damaging Het
Grpel2 G T 18: 61,726,290 R4S probably benign Het
Gstm1 T C 3: 108,017,756 Y7C probably damaging Het
Hace1 A T 10: 45,671,449 I497F probably benign Het
Hspg2 T C 4: 137,551,885 V3093A probably benign Het
Ighv3-4 A T 12: 114,253,675 F99I possibly damaging Het
Ints3 T C 3: 90,392,532 M963V probably null Het
Krt12 T C 11: 99,418,645 E263G Het
L1td1 T C 4: 98,733,986 F262L probably benign Het
Lrp2bp A G 8: 46,013,121 H110R probably benign Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Ncoa6 A G 2: 155,432,926 I135T probably damaging Het
Nfatc3 G A 8: 106,104,134 R695H probably damaging Het
Nkx1-2 T A 7: 132,599,499 K10* probably null Het
Olfr1278 A T 2: 111,292,288 T7S probably benign Het
Olfr1444 A G 19: 12,861,883 Y36C probably damaging Het
Olfr1464-ps1 T C 19: 13,282,671 H129R possibly damaging Het
Olfr314 G A 11: 58,786,809 A192T possibly damaging Het
Otog A G 7: 46,310,143 T719A probably damaging Het
Prkdc T G 16: 15,799,954 I3216M probably benign Het
Pygm A G 19: 6,388,157 D252G probably benign Het
Rae1 T A 2: 173,012,797 Y332* probably null Het
Rbm12 A T 2: 156,098,201 D50E unknown Het
Rbm6 G A 9: 107,779,579 R1000W probably damaging Het
Rd3l A T 12: 111,980,180 V54E possibly damaging Het
Rft1 T C 14: 30,682,757 V370A probably benign Het
Rfx8 T C 1: 39,670,519 I449M probably benign Het
Satb1 A T 17: 51,805,236 S117T possibly damaging Het
Slc24a2 T C 4: 87,049,907 Y370C probably damaging Het
Slc5a4b C A 10: 76,108,557 V85L probably damaging Het
Snrpn A T 7: 59,985,967 V95E possibly damaging Het
Spata33 A T 8: 123,222,019 N130I possibly damaging Het
Tap1 A G 17: 34,193,551 S521G probably damaging Het
Tbc1d13 C T 2: 30,142,417 T180I possibly damaging Het
Tgm7 G A 2: 121,109,710 probably benign Het
Tiam1 A G 16: 89,867,571 M583T probably damaging Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Vmn1r43 A T 6: 89,870,458 H15Q possibly damaging Het
Wisp2 A G 2: 163,829,065 D164G probably benign Het
Zfp329 A T 7: 12,810,490 V369E probably damaging Het
Zfp467 T A 6: 48,442,669 E35V possibly damaging Het
Other mutations in Fam83b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fam83b APN 9 76490978 missense probably benign 0.00
IGL01554:Fam83b APN 9 76502121 missense probably benign 0.33
IGL01694:Fam83b APN 9 76490990 missense probably benign 0.13
IGL02009:Fam83b APN 9 76492322 missense probably damaging 1.00
IGL02531:Fam83b APN 9 76492000 missense possibly damaging 0.61
IGL03328:Fam83b APN 9 76493042 missense probably benign 0.01
PIT4581001:Fam83b UTSW 9 76491152 missense probably damaging 1.00
R0110:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0469:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0510:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0732:Fam83b UTSW 9 76492928 nonsense probably null
R0946:Fam83b UTSW 9 76491397 missense probably damaging 0.96
R0961:Fam83b UTSW 9 76491295 missense probably damaging 0.97
R1101:Fam83b UTSW 9 76545670 missense possibly damaging 0.68
R1200:Fam83b UTSW 9 76492312 missense probably damaging 1.00
R1248:Fam83b UTSW 9 76503076 missense probably benign 0.35
R1420:Fam83b UTSW 9 76492612 missense possibly damaging 0.94
R1429:Fam83b UTSW 9 76492577 missense probably benign
R1939:Fam83b UTSW 9 76493080 missense probably damaging 1.00
R1992:Fam83b UTSW 9 76492022 missense probably benign
R2102:Fam83b UTSW 9 76492705 missense probably damaging 0.96
R2134:Fam83b UTSW 9 76491016 missense probably damaging 1.00
R2398:Fam83b UTSW 9 76502218 missense probably damaging 1.00
R2878:Fam83b UTSW 9 76490810 missense probably damaging 1.00
R4092:Fam83b UTSW 9 76491661 missense probably benign 0.24
R4204:Fam83b UTSW 9 76503053 missense probably benign 0.09
R4537:Fam83b UTSW 9 76492142 missense probably benign 0.10
R4920:Fam83b UTSW 9 76491868 missense probably benign
R5456:Fam83b UTSW 9 76492595 missense probably benign
R5473:Fam83b UTSW 9 76491500 missense probably damaging 1.00
R5488:Fam83b UTSW 9 76545599 missense probably benign 0.05
R5489:Fam83b UTSW 9 76545599 missense probably benign 0.05
R5876:Fam83b UTSW 9 76491850 missense possibly damaging 0.92
R6150:Fam83b UTSW 9 76492357 missense probably damaging 1.00
R6374:Fam83b UTSW 9 76492907 missense probably benign 0.31
R6468:Fam83b UTSW 9 76502131 nonsense probably null
R6912:Fam83b UTSW 9 76490932 missense probably damaging 0.99
R7022:Fam83b UTSW 9 76502112 frame shift probably null
R7073:Fam83b UTSW 9 76545749 missense probably benign 0.18
R7356:Fam83b UTSW 9 76492853 missense probably benign 0.05
R7665:Fam83b UTSW 9 76490875 missense probably damaging 1.00
R7762:Fam83b UTSW 9 76492432 missense possibly damaging 0.87
R7790:Fam83b UTSW 9 76492048 missense probably benign 0.01
R7869:Fam83b UTSW 9 76492144 missense possibly damaging 0.78
R7879:Fam83b UTSW 9 76492455 missense possibly damaging 0.76
R7957:Fam83b UTSW 9 76491985 missense probably benign 0.00
R8067:Fam83b UTSW 9 76491098 missense probably benign
R8983:Fam83b UTSW 9 76493075 missense probably damaging 1.00
R9361:Fam83b UTSW 9 76492794 missense probably benign 0.03
R9405:Fam83b UTSW 9 76491421 missense possibly damaging 0.93
R9475:Fam83b UTSW 9 76491803 missense probably benign 0.31
R9690:Fam83b UTSW 9 76491220 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGAGGTCTATGTGGGTACTCC -3'
(R):5'- TTGAAAGTTCCCCTCATCCAAC -3'

Sequencing Primer
(F):5'- CCTAAGAGTCCGGGCATCAC -3'
(R):5'- CATGGAGGCTTCATCAATGC -3'
Posted On 2022-10-06