Incidental Mutation 'R9657:Ptpn18'
ID 727355
Institutional Source Beutler Lab
Gene Symbol Ptpn18
Ensembl Gene ENSMUSG00000026126
Gene Name protein tyrosine phosphatase, non-receptor type 18
Synonyms Ptpk1, PTP-HSCF, FLP1, HSCF, PTP-K1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.167) question?
Stock # R9657 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 34498843-34514814 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 34512473 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 426 (A426E)
Ref Sequence ENSEMBL: ENSMUSP00000027302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027302] [ENSMUST00000188972] [ENSMUST00000190122]
AlphaFold Q61152
Predicted Effect possibly damaging
Transcript: ENSMUST00000027302
AA Change: A426E

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027302
Gene: ENSMUSG00000026126
AA Change: A426E

DomainStartEndE-ValueType
PTPc 25 293 7.77e-115 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188972
AA Change: A77E

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000190122
SMART Domains Protein: ENSMUSP00000139885
Gene: ENSMUSG00000026126

DomainStartEndE-ValueType
PTPc 2 269 9.1e-113 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,243,379 (GRCm39) D1747E probably benign Het
Acad11 T A 9: 103,953,035 (GRCm39) I88N possibly damaging Het
Atp2b4 T C 1: 133,656,478 (GRCm39) E724G probably damaging Het
Bcl2a1b T C 9: 89,081,599 (GRCm39) S63P probably damaging Het
Blzf1 T C 1: 164,134,023 (GRCm39) S9G probably benign Het
Ccdc121rt1 T C 1: 181,338,104 (GRCm39) T283A probably benign Het
Cdh22 T C 2: 164,965,715 (GRCm39) D488G probably benign Het
Cep290 A G 10: 100,351,003 (GRCm39) E688G possibly damaging Het
Cldn10 A C 14: 119,025,781 (GRCm39) E71D probably benign Het
Clip2 C T 5: 134,533,616 (GRCm39) R487Q probably benign Het
Cyp3a16 T C 5: 145,386,979 (GRCm39) D337G probably null Het
Dnah5 A T 15: 28,410,089 (GRCm39) D3654V probably damaging Het
Dock1 T C 7: 134,339,429 (GRCm39) S100P possibly damaging Het
Hdgfl2 T C 17: 56,405,978 (GRCm39) V488A unknown Het
Itih2 T C 2: 10,107,686 (GRCm39) T627A probably damaging Het
Katnip A G 7: 125,441,956 (GRCm39) S648G probably benign Het
Klhl33 T C 14: 51,134,117 (GRCm39) D144G probably benign Het
Lca5l G A 16: 95,974,953 (GRCm39) Q324* probably null Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mical2 A G 7: 111,921,806 (GRCm39) T542A probably benign Het
Moxd1 T A 10: 24,128,485 (GRCm39) V179E probably benign Het
Myh7b A G 2: 155,455,963 (GRCm39) Y116C probably damaging Het
Myoc C T 1: 162,467,229 (GRCm39) R133* probably null Het
Nol3 A T 8: 106,005,641 (GRCm39) I12F probably damaging Het
Nrap A G 19: 56,352,377 (GRCm39) V605A probably benign Het
Or5w13 T C 2: 87,524,121 (GRCm39) Y35C probably damaging Het
Or9m2 A C 2: 87,821,310 (GRCm39) N285T probably damaging Het
Pag1 G T 3: 9,769,791 (GRCm39) S52R probably damaging Het
Pbxip1 A G 3: 89,355,056 (GRCm39) D525G probably benign Het
Pla2g4f A G 2: 120,135,138 (GRCm39) F437L probably benign Het
Podn A C 4: 107,884,231 (GRCm39) I86S probably damaging Het
Postn A G 3: 54,290,820 (GRCm39) T676A probably benign Het
Ppp1r1c A G 2: 79,638,718 (GRCm39) E104G probably benign Het
Prss53 T C 7: 127,486,238 (GRCm39) T436A probably damaging Het
Psme4 A T 11: 30,788,980 (GRCm39) E1127D probably benign Het
Ptprz1 T G 6: 23,042,377 (GRCm39) C2044G possibly damaging Het
Rad54l2 C A 9: 106,581,372 (GRCm39) V850L probably damaging Het
Ranbp9 A G 13: 43,557,155 (GRCm39) I28T unknown Het
Rapgef2 A T 3: 78,999,191 (GRCm39) V527E probably damaging Het
Rere C A 4: 150,699,390 (GRCm39) P825T unknown Het
Rundc3a A G 11: 102,291,578 (GRCm39) T349A probably benign Het
Scn2a T C 2: 65,566,032 (GRCm39) F1352S probably damaging Het
Senp7 T A 16: 55,944,295 (GRCm39) C206* probably null Het
Serac1 C T 17: 6,119,658 (GRCm39) V91I probably benign Het
Serpina1f G A 12: 103,656,050 (GRCm39) Q393* probably null Het
Slc8a1 T C 17: 81,955,244 (GRCm39) E598G probably damaging Het
Slmap A T 14: 26,151,013 (GRCm39) H518Q probably benign Het
Spg11 G A 2: 121,910,781 (GRCm39) R1199C probably damaging Het
Tada1 T C 1: 166,214,312 (GRCm39) S104P possibly damaging Het
Tbck A G 3: 132,421,451 (GRCm39) D186G probably damaging Het
Tdrd9 A C 12: 112,002,824 (GRCm39) R824S possibly damaging Het
Tmem161a T C 8: 70,630,260 (GRCm39) probably null Het
Trim55 G A 3: 19,728,671 (GRCm39) G494D possibly damaging Het
Ttc17 T A 2: 94,237,010 (GRCm39) M1L probably benign Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Ugt3a1 A C 15: 9,280,133 (GRCm39) S32R probably damaging Het
Vgll3 T C 16: 65,636,343 (GRCm39) S220P probably benign Het
Virma A G 4: 11,544,898 (GRCm39) E1569G probably damaging Het
Vmn1r54 C G 6: 90,246,984 (GRCm39) F299L probably benign Het
Vmn2r114 A G 17: 23,510,690 (GRCm39) S597P probably damaging Het
Wdr7 A G 18: 64,057,918 (GRCm39) D1249G probably damaging Het
Wdr97 A G 15: 76,245,476 (GRCm39) Y1271C Het
Yju2b T C 8: 84,987,084 (GRCm39) K138E possibly damaging Het
Ypel4 A G 2: 84,568,068 (GRCm39) Y108C probably damaging Het
Zfp770 A G 2: 114,027,766 (GRCm39) V101A probably damaging Het
Zfyve9 A T 4: 108,575,729 (GRCm39) C451S probably damaging Het
Other mutations in Ptpn18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ptpn18 APN 1 34,502,200 (GRCm39) missense probably damaging 0.98
IGL01611:Ptpn18 APN 1 34,498,898 (GRCm39) utr 5 prime probably benign
IGL01633:Ptpn18 APN 1 34,510,989 (GRCm39) missense probably benign 0.03
IGL03379:Ptpn18 APN 1 34,509,338 (GRCm39) splice site probably null
R0848:Ptpn18 UTSW 1 34,501,783 (GRCm39) missense probably damaging 1.00
R1400:Ptpn18 UTSW 1 34,502,587 (GRCm39) critical splice donor site probably null
R1973:Ptpn18 UTSW 1 34,502,190 (GRCm39) missense probably damaging 1.00
R2040:Ptpn18 UTSW 1 34,509,300 (GRCm39) missense probably damaging 0.99
R2113:Ptpn18 UTSW 1 34,510,742 (GRCm39) missense probably damaging 1.00
R2963:Ptpn18 UTSW 1 34,510,773 (GRCm39) nonsense probably null
R4061:Ptpn18 UTSW 1 34,512,011 (GRCm39) missense possibly damaging 0.66
R4062:Ptpn18 UTSW 1 34,512,011 (GRCm39) missense possibly damaging 0.66
R4509:Ptpn18 UTSW 1 34,501,823 (GRCm39) missense possibly damaging 0.49
R4522:Ptpn18 UTSW 1 34,512,041 (GRCm39) missense probably benign
R4626:Ptpn18 UTSW 1 34,510,873 (GRCm39) splice site probably null
R4978:Ptpn18 UTSW 1 34,508,894 (GRCm39) intron probably benign
R5260:Ptpn18 UTSW 1 34,502,591 (GRCm39) splice site probably benign
R5335:Ptpn18 UTSW 1 34,502,259 (GRCm39) missense probably damaging 1.00
R5481:Ptpn18 UTSW 1 34,510,744 (GRCm39) missense possibly damaging 0.67
R5865:Ptpn18 UTSW 1 34,510,644 (GRCm39) splice site probably benign
R7038:Ptpn18 UTSW 1 34,498,906 (GRCm39) start codon destroyed probably null 1.00
R7225:Ptpn18 UTSW 1 34,511,927 (GRCm39) missense possibly damaging 0.58
R7290:Ptpn18 UTSW 1 34,501,892 (GRCm39) critical splice donor site probably null
R7411:Ptpn18 UTSW 1 34,511,273 (GRCm39) critical splice donor site probably null
R7434:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7441:Ptpn18 UTSW 1 34,512,416 (GRCm39) missense probably benign 0.00
R7442:Ptpn18 UTSW 1 34,501,831 (GRCm39) missense probably benign 0.02
R7462:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7463:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7464:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7465:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7535:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7537:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7678:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7689:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7899:Ptpn18 UTSW 1 34,508,986 (GRCm39) splice site probably null
R8543:Ptpn18 UTSW 1 34,511,229 (GRCm39) missense probably benign 0.00
R8821:Ptpn18 UTSW 1 34,511,271 (GRCm39) missense probably null 1.00
R8831:Ptpn18 UTSW 1 34,511,271 (GRCm39) missense probably null 1.00
R8858:Ptpn18 UTSW 1 34,502,196 (GRCm39) missense possibly damaging 0.88
R8879:Ptpn18 UTSW 1 34,502,211 (GRCm39) missense probably benign 0.23
R8924:Ptpn18 UTSW 1 34,498,966 (GRCm39) missense probably benign 0.02
X0065:Ptpn18 UTSW 1 34,508,972 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGACCTCCGAACTTGG -3'
(R):5'- GCGCAAGTTGAAGCCTAAG -3'

Sequencing Primer
(F):5'- AACTTGGACACGCCCATGG -3'
(R):5'- CCTAAGGGAAGAAGGGCTCC -3'
Posted On 2022-10-06