Incidental Mutation 'R9657:Scn2a'
ID 727362
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Name sodium channel, voltage-gated, type II, alpha
Synonyms A230052E19Rik, Nav1.2, Scn2a1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9657 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 65451115-65597791 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65566032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1352 (F1352S)
Ref Sequence ENSEMBL: ENSMUSP00000028377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]
AlphaFold B1AWN6
Predicted Effect probably damaging
Transcript: ENSMUST00000028377
AA Change: F1352S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: F1352S

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100067
AA Change: F1352S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: F1352S

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200829
AA Change: F1352S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: F1352S

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,243,379 (GRCm39) D1747E probably benign Het
Acad11 T A 9: 103,953,035 (GRCm39) I88N possibly damaging Het
Atp2b4 T C 1: 133,656,478 (GRCm39) E724G probably damaging Het
Bcl2a1b T C 9: 89,081,599 (GRCm39) S63P probably damaging Het
Blzf1 T C 1: 164,134,023 (GRCm39) S9G probably benign Het
Ccdc121rt1 T C 1: 181,338,104 (GRCm39) T283A probably benign Het
Cdh22 T C 2: 164,965,715 (GRCm39) D488G probably benign Het
Cep290 A G 10: 100,351,003 (GRCm39) E688G possibly damaging Het
Cldn10 A C 14: 119,025,781 (GRCm39) E71D probably benign Het
Clip2 C T 5: 134,533,616 (GRCm39) R487Q probably benign Het
Cyp3a16 T C 5: 145,386,979 (GRCm39) D337G probably null Het
Dnah5 A T 15: 28,410,089 (GRCm39) D3654V probably damaging Het
Dock1 T C 7: 134,339,429 (GRCm39) S100P possibly damaging Het
Hdgfl2 T C 17: 56,405,978 (GRCm39) V488A unknown Het
Itih2 T C 2: 10,107,686 (GRCm39) T627A probably damaging Het
Katnip A G 7: 125,441,956 (GRCm39) S648G probably benign Het
Klhl33 T C 14: 51,134,117 (GRCm39) D144G probably benign Het
Lca5l G A 16: 95,974,953 (GRCm39) Q324* probably null Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mical2 A G 7: 111,921,806 (GRCm39) T542A probably benign Het
Moxd1 T A 10: 24,128,485 (GRCm39) V179E probably benign Het
Myh7b A G 2: 155,455,963 (GRCm39) Y116C probably damaging Het
Myoc C T 1: 162,467,229 (GRCm39) R133* probably null Het
Nol3 A T 8: 106,005,641 (GRCm39) I12F probably damaging Het
Nrap A G 19: 56,352,377 (GRCm39) V605A probably benign Het
Or5w13 T C 2: 87,524,121 (GRCm39) Y35C probably damaging Het
Or9m2 A C 2: 87,821,310 (GRCm39) N285T probably damaging Het
Pag1 G T 3: 9,769,791 (GRCm39) S52R probably damaging Het
Pbxip1 A G 3: 89,355,056 (GRCm39) D525G probably benign Het
Pla2g4f A G 2: 120,135,138 (GRCm39) F437L probably benign Het
Podn A C 4: 107,884,231 (GRCm39) I86S probably damaging Het
Postn A G 3: 54,290,820 (GRCm39) T676A probably benign Het
Ppp1r1c A G 2: 79,638,718 (GRCm39) E104G probably benign Het
Prss53 T C 7: 127,486,238 (GRCm39) T436A probably damaging Het
Psme4 A T 11: 30,788,980 (GRCm39) E1127D probably benign Het
Ptpn18 C A 1: 34,512,473 (GRCm39) A426E possibly damaging Het
Ptprz1 T G 6: 23,042,377 (GRCm39) C2044G possibly damaging Het
Rad54l2 C A 9: 106,581,372 (GRCm39) V850L probably damaging Het
Ranbp9 A G 13: 43,557,155 (GRCm39) I28T unknown Het
Rapgef2 A T 3: 78,999,191 (GRCm39) V527E probably damaging Het
Rere C A 4: 150,699,390 (GRCm39) P825T unknown Het
Rundc3a A G 11: 102,291,578 (GRCm39) T349A probably benign Het
Senp7 T A 16: 55,944,295 (GRCm39) C206* probably null Het
Serac1 C T 17: 6,119,658 (GRCm39) V91I probably benign Het
Serpina1f G A 12: 103,656,050 (GRCm39) Q393* probably null Het
Slc8a1 T C 17: 81,955,244 (GRCm39) E598G probably damaging Het
Slmap A T 14: 26,151,013 (GRCm39) H518Q probably benign Het
Spg11 G A 2: 121,910,781 (GRCm39) R1199C probably damaging Het
Tada1 T C 1: 166,214,312 (GRCm39) S104P possibly damaging Het
Tbck A G 3: 132,421,451 (GRCm39) D186G probably damaging Het
Tdrd9 A C 12: 112,002,824 (GRCm39) R824S possibly damaging Het
Tmem161a T C 8: 70,630,260 (GRCm39) probably null Het
Trim55 G A 3: 19,728,671 (GRCm39) G494D possibly damaging Het
Ttc17 T A 2: 94,237,010 (GRCm39) M1L probably benign Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Ugt3a1 A C 15: 9,280,133 (GRCm39) S32R probably damaging Het
Vgll3 T C 16: 65,636,343 (GRCm39) S220P probably benign Het
Virma A G 4: 11,544,898 (GRCm39) E1569G probably damaging Het
Vmn1r54 C G 6: 90,246,984 (GRCm39) F299L probably benign Het
Vmn2r114 A G 17: 23,510,690 (GRCm39) S597P probably damaging Het
Wdr7 A G 18: 64,057,918 (GRCm39) D1249G probably damaging Het
Wdr97 A G 15: 76,245,476 (GRCm39) Y1271C Het
Yju2b T C 8: 84,987,084 (GRCm39) K138E possibly damaging Het
Ypel4 A G 2: 84,568,068 (GRCm39) Y108C probably damaging Het
Zfp770 A G 2: 114,027,766 (GRCm39) V101A probably damaging Het
Zfyve9 A T 4: 108,575,729 (GRCm39) C451S probably damaging Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65,594,784 (GRCm39) missense probably benign
IGL00159:Scn2a APN 2 65,573,434 (GRCm39) missense probably damaging 1.00
IGL00418:Scn2a APN 2 65,594,866 (GRCm39) missense probably benign 0.43
IGL00753:Scn2a APN 2 65,514,207 (GRCm39) missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00774:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00847:Scn2a APN 2 65,501,078 (GRCm39) missense probably damaging 1.00
IGL01155:Scn2a APN 2 65,548,092 (GRCm39) missense probably damaging 1.00
IGL01329:Scn2a APN 2 65,547,852 (GRCm39) missense probably benign 0.05
IGL01537:Scn2a APN 2 65,546,219 (GRCm39) missense probably benign 0.00
IGL01672:Scn2a APN 2 65,582,278 (GRCm39) missense probably damaging 1.00
IGL01958:Scn2a APN 2 65,532,173 (GRCm39) missense probably damaging 1.00
IGL02028:Scn2a APN 2 65,594,002 (GRCm39) missense probably damaging 0.96
IGL02142:Scn2a APN 2 65,546,182 (GRCm39) missense probably damaging 1.00
IGL02160:Scn2a APN 2 65,560,460 (GRCm39) missense probably damaging 1.00
IGL02183:Scn2a APN 2 65,501,947 (GRCm39) missense probably benign 0.20
IGL02341:Scn2a APN 2 65,518,721 (GRCm39) missense probably damaging 1.00
IGL02504:Scn2a APN 2 65,514,228 (GRCm39) missense probably benign 0.02
IGL02530:Scn2a APN 2 65,560,522 (GRCm39) missense probably damaging 0.99
IGL02621:Scn2a APN 2 65,579,223 (GRCm39) splice site probably benign
IGL02652:Scn2a APN 2 65,532,382 (GRCm39) missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65,532,188 (GRCm39) missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65,501,997 (GRCm39) missense probably damaging 0.99
IGL03329:Scn2a APN 2 65,594,973 (GRCm39) missense probably benign
IGL03336:Scn2a APN 2 65,519,088 (GRCm39) missense probably damaging 1.00
IGL03391:Scn2a APN 2 65,594,557 (GRCm39) missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65,546,074 (GRCm39) missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65,514,182 (GRCm39) missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65,542,252 (GRCm39) missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65,518,763 (GRCm39) missense probably damaging 1.00
R0021:Scn2a UTSW 2 65,500,859 (GRCm39) missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65,542,160 (GRCm39) missense probably benign 0.01
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0335:Scn2a UTSW 2 65,512,435 (GRCm39) missense probably damaging 1.00
R0508:Scn2a UTSW 2 65,548,186 (GRCm39) missense probably damaging 0.99
R0558:Scn2a UTSW 2 65,542,269 (GRCm39) missense probably benign 0.26
R0600:Scn2a UTSW 2 65,532,177 (GRCm39) missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65,582,340 (GRCm39) missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65,517,123 (GRCm39) splice site probably benign
R1244:Scn2a UTSW 2 65,593,999 (GRCm39) missense probably damaging 0.98
R1386:Scn2a UTSW 2 65,519,085 (GRCm39) missense probably damaging 1.00
R1434:Scn2a UTSW 2 65,532,335 (GRCm39) missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65,594,938 (GRCm39) missense probably benign
R1448:Scn2a UTSW 2 65,514,189 (GRCm39) missense probably benign 0.17
R1460:Scn2a UTSW 2 65,532,187 (GRCm39) missense probably damaging 0.96
R1553:Scn2a UTSW 2 65,544,180 (GRCm39) nonsense probably null
R1642:Scn2a UTSW 2 65,514,041 (GRCm39) missense probably damaging 1.00
R1803:Scn2a UTSW 2 65,501,111 (GRCm39) splice site probably null
R1981:Scn2a UTSW 2 65,520,514 (GRCm39) missense probably damaging 1.00
R2002:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R2068:Scn2a UTSW 2 65,582,417 (GRCm39) missense probably benign 0.14
R2125:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2126:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2876:Scn2a UTSW 2 65,546,241 (GRCm39) missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65,518,715 (GRCm39) missense probably damaging 1.00
R3113:Scn2a UTSW 2 65,579,129 (GRCm39) missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3750:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3765:Scn2a UTSW 2 65,513,054 (GRCm39) missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65,512,375 (GRCm39) missense probably benign 0.14
R4585:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4586:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4588:Scn2a UTSW 2 65,544,111 (GRCm39) missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65,582,371 (GRCm39) missense probably benign 0.04
R5108:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R5161:Scn2a UTSW 2 65,594,935 (GRCm39) missense probably benign 0.00
R5235:Scn2a UTSW 2 65,582,355 (GRCm39) missense probably damaging 1.00
R5464:Scn2a UTSW 2 65,532,100 (GRCm39) missense probably damaging 1.00
R5586:Scn2a UTSW 2 65,537,639 (GRCm39) nonsense probably null
R5630:Scn2a UTSW 2 65,556,709 (GRCm39) missense probably damaging 1.00
R5715:Scn2a UTSW 2 65,547,928 (GRCm39) missense probably benign 0.27
R5730:Scn2a UTSW 2 65,512,882 (GRCm39) nonsense probably null
R5734:Scn2a UTSW 2 65,548,066 (GRCm39) missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65,594,827 (GRCm39) missense probably benign 0.00
R6133:Scn2a UTSW 2 65,573,448 (GRCm39) missense probably benign 0.35
R6547:Scn2a UTSW 2 65,546,241 (GRCm39) missense probably benign 0.29
R6549:Scn2a UTSW 2 65,595,018 (GRCm39) missense probably benign 0.05
R6818:Scn2a UTSW 2 65,519,013 (GRCm39) nonsense probably null
R6999:Scn2a UTSW 2 65,512,453 (GRCm39) missense probably benign
R7069:Scn2a UTSW 2 65,594,950 (GRCm39) missense probably benign 0.00
R7073:Scn2a UTSW 2 65,558,787 (GRCm39) missense probably benign 0.00
R7125:Scn2a UTSW 2 65,594,277 (GRCm39) missense probably damaging 1.00
R7178:Scn2a UTSW 2 65,579,197 (GRCm39) nonsense probably null
R7179:Scn2a UTSW 2 65,532,323 (GRCm39) missense probably damaging 1.00
R7203:Scn2a UTSW 2 65,578,663 (GRCm39) missense probably benign 0.01
R7227:Scn2a UTSW 2 65,582,367 (GRCm39) missense probably damaging 0.98
R7269:Scn2a UTSW 2 65,594,113 (GRCm39) missense probably damaging 1.00
R7358:Scn2a UTSW 2 65,512,850 (GRCm39) nonsense probably null
R7388:Scn2a UTSW 2 65,518,998 (GRCm39) missense probably damaging 1.00
R7491:Scn2a UTSW 2 65,532,352 (GRCm39) missense probably damaging 0.99
R7619:Scn2a UTSW 2 65,546,247 (GRCm39) missense probably damaging 1.00
R7695:Scn2a UTSW 2 65,542,251 (GRCm39) missense probably damaging 0.99
R7735:Scn2a UTSW 2 65,594,013 (GRCm39) missense probably benign 0.40
R7911:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R8096:Scn2a UTSW 2 65,594,366 (GRCm39) missense probably damaging 0.98
R8172:Scn2a UTSW 2 65,520,672 (GRCm39) missense probably benign 0.01
R8220:Scn2a UTSW 2 65,520,620 (GRCm39) missense probably benign 0.01
R8333:Scn2a UTSW 2 65,514,191 (GRCm39) missense probably benign 0.01
R8416:Scn2a UTSW 2 65,511,345 (GRCm39) missense probably benign 0.00
R8850:Scn2a UTSW 2 65,518,730 (GRCm39) missense probably damaging 1.00
R8897:Scn2a UTSW 2 65,546,002 (GRCm39) critical splice acceptor site probably null
R8977:Scn2a UTSW 2 65,594,014 (GRCm39) missense probably damaging 0.99
R8992:Scn2a UTSW 2 65,594,242 (GRCm39) missense probably damaging 1.00
R9190:Scn2a UTSW 2 65,511,346 (GRCm39) missense probably benign 0.00
R9206:Scn2a UTSW 2 65,548,131 (GRCm39) missense probably damaging 1.00
R9355:Scn2a UTSW 2 65,594,433 (GRCm39) missense probably damaging 1.00
R9452:Scn2a UTSW 2 65,595,163 (GRCm39) missense probably benign
R9529:Scn2a UTSW 2 65,594,932 (GRCm39) missense probably damaging 0.99
R9567:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R9569:Scn2a UTSW 2 65,560,622 (GRCm39) missense probably damaging 1.00
R9715:Scn2a UTSW 2 65,579,149 (GRCm39) missense possibly damaging 0.93
R9761:Scn2a UTSW 2 65,566,030 (GRCm39) missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65,582,212 (GRCm39) missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65,548,079 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAACCTAGATCCTCTTGAGCAG -3'
(R):5'- GTCCCACGTTGTCAAAGTTG -3'

Sequencing Primer
(F):5'- TACTATTCAGATGCCCTCAGAGG -3'
(R):5'- AAAGTTGACTTTCACATTCTTCCAC -3'
Posted On 2022-10-06