Mutagenetix > Incidental Mutation

Incidental Mutation 'R9657:Mical2'

727388

Institutional Source

Beutler Lab

Gene Symbol

Mical2

Ensembl Gene

ENSMUSG00000038244

Gene Name

microtubule associated monooxygenase, calponin and LIM domain containing 2

Synonyms

5330438E18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.366) question?

Stock #

R9657 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

112225856-112355194 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 112322599 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 542 (T542A)

Ref Sequence

ENSEMBL: ENSMUSP00000047639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037991] [ENSMUST00000050149]

AlphaFold

Q8BML1
Q9D5U9

Predicted Effect

probably benign
Transcript: ENSMUST00000037991
AA Change: T542A

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000047639
Gene: ENSMUSG00000038244
AA Change: T542A

Domain	Start	End	E-Value	Type
Pfam:FAD_binding_3	86	143	1e-8	PFAM
Pfam:FAD_binding_2	88	127	3.2e-6	PFAM
low complexity region	175	188	N/A	INTRINSIC
low complexity region	500	515	N/A	INTRINSIC
CH	518	617	4.14e-17	SMART
low complexity region	691	700	N/A	INTRINSIC
low complexity region	894	925	N/A	INTRINSIC
LIM	979	1033	9.91e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000050149
AA Change: T542A

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000051163
Gene: ENSMUSG00000038244
AA Change: T542A

Domain	Start	End	E-Value	Type
Pfam:FAD_binding_3	86	143	1.1e-8	PFAM
Pfam:FAD_binding_2	88	127	1.5e-6	PFAM
Pfam:Pyr_redox_2	88	259	1.3e-6	PFAM
low complexity region	500	515	N/A	INTRINSIC
CH	518	617	4.14e-17	SMART
low complexity region	691	700	N/A	INTRINSIC
LIM	752	806	9.91e-10	SMART
low complexity region	918	926	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,293,379	D1747E	probably benign	Het
Acad11	T	A	9: 104,075,836	I88N	possibly damaging	Het
Atp2b4	T	C	1: 133,728,740	E724G	probably damaging	Het
Bcl2a1b	T	C	9: 89,199,546	S63P	probably damaging	Het
Blzf1	T	C	1: 164,306,454	S9G	probably benign	Het
Ccdc121	T	C	1: 181,510,539	T283A	probably benign	Het
Ccdc130	T	C	8: 84,260,455	K138E	possibly damaging	Het
Cdh22	T	C	2: 165,123,795	D488G	probably benign	Het
Cep290	A	G	10: 100,515,141	E688G	possibly damaging	Het
Cldn10	A	C	14: 118,788,369	E71D	probably benign	Het
Clip2	C	T	5: 134,504,762	R487Q	probably benign	Het
Cyp3a16	T	C	5: 145,450,169	D337G	probably null	Het
D430042O09Rik	A	G	7: 125,842,784	S648G	probably benign	Het
Dnah5	A	T	15: 28,409,943	D3654V	probably damaging	Het
Dock1	T	C	7: 134,737,700	S100P	possibly damaging	Het
Gm35339	A	G	15: 76,361,276	Y1271C		Het
Hdgfl2	T	C	17: 56,098,978	V488A	unknown	Het
Itih2	T	C	2: 10,102,875	T627A	probably damaging	Het
Klhl33	T	C	14: 50,896,660	D144G	probably benign	Het
Lca5l	G	A	16: 96,173,753	Q324*	probably null	Het
Mcm5	C	T	8: 75,117,540	S313F	probably benign	Het
Moxd1	T	A	10: 24,252,587	V179E	probably benign	Het
Myh7b	A	G	2: 155,614,043	Y116C	probably damaging	Het
Myoc	C	T	1: 162,639,660	R133*	probably null	Het
Nol3	A	T	8: 105,279,009	I12F	probably damaging	Het
Nrap	A	G	19: 56,363,945	V605A	probably benign	Het
Olfr1136	T	C	2: 87,693,777	Y35C	probably damaging	Het
Olfr1158	A	C	2: 87,990,966	N285T	probably damaging	Het
Pag1	G	T	3: 9,704,731	S52R	probably damaging	Het
Pbxip1	A	G	3: 89,447,749	D525G	probably benign	Het
Pla2g4f	A	G	2: 120,304,657	F437L	probably benign	Het
Podn	A	C	4: 108,027,034	I86S	probably damaging	Het
Postn	A	G	3: 54,383,399	T676A	probably benign	Het
Ppp1r1c	A	G	2: 79,808,374	E104G	probably benign	Het
Prss53	T	C	7: 127,887,066	T436A	probably damaging	Het
Psme4	A	T	11: 30,838,980	E1127D	probably benign	Het
Ptpn18	C	A	1: 34,473,392	A426E	possibly damaging	Het
Ptprz1	T	G	6: 23,042,378	C2044G	possibly damaging	Het
Rad54l2	C	A	9: 106,704,173	V850L	probably damaging	Het
Ranbp9	A	G	13: 43,403,679	I28T	unknown	Het
Rapgef2	A	T	3: 79,091,884	V527E	probably damaging	Het
Rere	C	A	4: 150,614,933	P825T	unknown	Het
Rundc3a	A	G	11: 102,400,752	T349A	probably benign	Het
Scn2a	T	C	2: 65,735,688	F1352S	probably damaging	Het
Senp7	T	A	16: 56,123,932	C206*	probably null	Het
Serac1	C	T	17: 6,069,383	V91I	probably benign	Het
Serpina1f	G	A	12: 103,689,791	Q393*	probably null	Het
Slc8a1	T	C	17: 81,647,815	E598G	probably damaging	Het
Slmap	A	T	14: 26,429,858	H518Q	probably benign	Het
Spg11	G	A	2: 122,080,300	R1199C	probably damaging	Het
Tada1	T	C	1: 166,386,743	S104P	possibly damaging	Het
Tbck	A	G	3: 132,715,690	D186G	probably damaging	Het
Tdrd9	A	C	12: 112,036,390	R824S	possibly damaging	Het
Tmem161a	T	C	8: 70,177,610		probably null	Het
Trim55	G	A	3: 19,674,507	G494D	possibly damaging	Het
Ttc17	T	A	2: 94,406,665	M1L	probably benign	Het
Ttn	C	T	2: 76,885,013	E7912K	unknown	Het
Ugt3a1	A	C	15: 9,280,047	S32R	probably damaging	Het
Vgll3	T	C	16: 65,839,457	S220P	probably benign	Het
Virma	A	G	4: 11,544,898	E1569G	probably damaging	Het
Vmn1r54	C	G	6: 90,270,002	F299L	probably benign	Het
Vmn2r114	A	G	17: 23,291,716	S597P	probably damaging	Het
Wdr7	A	G	18: 63,924,847	D1249G	probably damaging	Het
Ypel4	A	G	2: 84,737,724	Y108C	probably damaging	Het
Zfp770	A	G	2: 114,197,285	V101A	probably damaging	Het
Zfyve9	A	T	4: 108,718,532	C451S	probably damaging	Het

Other mutations in Mical2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00886:Mical2	APN	7	112315072	missense	probably benign	0.00
IGL00934:Mical2	APN	7	112349403	missense	probably damaging	1.00
IGL00941:Mical2	APN	7	112321445	splice site	probably benign
IGL01020:Mical2	APN	7	112315076	splice site	probably benign
IGL01395:Mical2	APN	7	112323585	missense	probably damaging	1.00
IGL01658:Mical2	APN	7	112314998	missense	probably damaging	1.00
IGL02040:Mical2	APN	7	112311406	missense	probably damaging	1.00
IGL02388:Mical2	APN	7	112335413	missense	probably benign
IGL02551:Mical2	APN	7	112323990	missense	probably benign	0.01
IGL02578:Mical2	APN	7	112351373	missense	probably benign	0.05
IGL02751:Mical2	APN	7	112332036	missense	probably benign	0.11
R0101:Mical2	UTSW	7	112336867	missense	possibly damaging	0.86
R0504:Mical2	UTSW	7	112271317	missense	probably benign	0.00
R0594:Mical2	UTSW	7	112318450	missense	probably damaging	0.97
R0609:Mical2	UTSW	7	112321440	splice site	probably null
R1542:Mical2	UTSW	7	112309468	missense	probably damaging	1.00
R1740:Mical2	UTSW	7	112333836	missense	probably benign
R1855:Mical2	UTSW	7	112345282	missense	probably benign	0.21
R2086:Mical2	UTSW	7	112318603	missense	probably benign	0.31
R2136:Mical2	UTSW	7	112271515	missense	possibly damaging	0.72
R2418:Mical2	UTSW	7	112320734	critical splice donor site	probably null
R3053:Mical2	UTSW	7	112311423	missense	probably damaging	1.00
R4308:Mical2	UTSW	7	112331992	missense	probably benign	0.27
R4663:Mical2	UTSW	7	112328677	missense	possibly damaging	0.80
R4868:Mical2	UTSW	7	112318624	missense	probably damaging	1.00
R4902:Mical2	UTSW	7	112336900	missense	probably benign
R5112:Mical2	UTSW	7	112320611	missense	probably damaging	1.00
R5487:Mical2	UTSW	7	112320635	missense	probably damaging	1.00
R5563:Mical2	UTSW	7	112314978	missense	probably damaging	1.00
R5817:Mical2	UTSW	7	112323659	missense	probably benign
R5987:Mical2	UTSW	7	112334948	missense	probably benign	0.00
R6087:Mical2	UTSW	7	112318485	nonsense	probably null
R6209:Mical2	UTSW	7	112324086	splice site	probably null
R6311:Mical2	UTSW	7	112323558	missense	probably damaging	1.00
R6319:Mical2	UTSW	7	112328677	missense	possibly damaging	0.80
R6578:Mical2	UTSW	7	112311445	missense	probably damaging	1.00
R6782:Mical2	UTSW	7	112346761	missense	probably damaging	1.00
R7061:Mical2	UTSW	7	112346801	missense	probably benign	0.10
R7147:Mical2	UTSW	7	112323603	missense	possibly damaging	0.77
R7260:Mical2	UTSW	7	112319794	missense	probably benign	0.10
R7266:Mical2	UTSW	7	112303756	missense	probably damaging	1.00
R7391:Mical2	UTSW	7	112320609	missense	probably damaging	1.00
R7724:Mical2	UTSW	7	112323626	missense	probably damaging	1.00
R7747:Mical2	UTSW	7	112333839	missense	probably benign	0.02
R7818:Mical2	UTSW	7	112345307	missense	probably damaging	1.00
R8022:Mical2	UTSW	7	112303767	missense	probably damaging	1.00
R8429:Mical2	UTSW	7	112345253	missense	probably benign	0.01
R8505:Mical2	UTSW	7	112319800	missense	probably benign	0.02
R8532:Mical2	UTSW	7	112318544	missense	probably damaging	1.00
R8862:Mical2	UTSW	7	112311367	missense	probably damaging	1.00
R8988:Mical2	UTSW	7	112311454	missense	possibly damaging	0.63
R9123:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9127:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9128:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9129:Mical2	UTSW	7	112271382	missense	possibly damaging	0.61
R9187:Mical2	UTSW	7	112303590	nonsense	probably null
R9310:Mical2	UTSW	7	112351713	missense	probably benign	0.45
R9399:Mical2	UTSW	7	112346875	missense	probably damaging	1.00
R9500:Mical2	UTSW	7	112336847	critical splice acceptor site	probably null
R9652:Mical2	UTSW	7	112346789	missense	probably damaging	1.00
R9756:Mical2	UTSW	7	112303721	missense	probably damaging	0.99
R9789:Mical2	UTSW	7	112346789	missense	probably damaging	1.00
RF008:Mical2	UTSW	7	112323626	missense	probably damaging	1.00
X0062:Mical2	UTSW	7	112346843	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGTGGCCATCAGGGTTAC -3'
(R):5'- CATGTTGCTGTCCAAATGAGG -3'

Sequencing Primer
(F):5'- GCCATCAGGGTTACATTTATGTC -3'
(R):5'- ATACTGAGCTGGGTTGGAG -3'

Posted On

2022-10-06