Incidental Mutation 'R9657:Cep290'
ID 727400
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Name centrosomal protein 290
Synonyms b2b1454Clo, Nphp6, b2b1752Clo
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R9657 (G1)
Quality Score 179.009
Status Not validated
Chromosome 10
Chromosomal Location 100487558-100574840 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100515141 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 688 (E688G)
Ref Sequence ENSEMBL: ENSMUSP00000130899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]
AlphaFold Q6A078
Predicted Effect possibly damaging
Transcript: ENSMUST00000164751
AA Change: E688G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: E688G

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000219765
AA Change: E681G

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220346
AA Change: E688G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,293,379 D1747E probably benign Het
Acad11 T A 9: 104,075,836 I88N possibly damaging Het
Atp2b4 T C 1: 133,728,740 E724G probably damaging Het
Bcl2a1b T C 9: 89,199,546 S63P probably damaging Het
Blzf1 T C 1: 164,306,454 S9G probably benign Het
Ccdc121 T C 1: 181,510,539 T283A probably benign Het
Ccdc130 T C 8: 84,260,455 K138E possibly damaging Het
Cdh22 T C 2: 165,123,795 D488G probably benign Het
Cldn10 A C 14: 118,788,369 E71D probably benign Het
Clip2 C T 5: 134,504,762 R487Q probably benign Het
Cyp3a16 T C 5: 145,450,169 D337G probably null Het
D430042O09Rik A G 7: 125,842,784 S648G probably benign Het
Dnah5 A T 15: 28,409,943 D3654V probably damaging Het
Dock1 T C 7: 134,737,700 S100P possibly damaging Het
Gm35339 A G 15: 76,361,276 Y1271C Het
Hdgfl2 T C 17: 56,098,978 V488A unknown Het
Itih2 T C 2: 10,102,875 T627A probably damaging Het
Klhl33 T C 14: 50,896,660 D144G probably benign Het
Lca5l G A 16: 96,173,753 Q324* probably null Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mical2 A G 7: 112,322,599 T542A probably benign Het
Moxd1 T A 10: 24,252,587 V179E probably benign Het
Myh7b A G 2: 155,614,043 Y116C probably damaging Het
Myoc C T 1: 162,639,660 R133* probably null Het
Nol3 A T 8: 105,279,009 I12F probably damaging Het
Nrap A G 19: 56,363,945 V605A probably benign Het
Olfr1136 T C 2: 87,693,777 Y35C probably damaging Het
Olfr1158 A C 2: 87,990,966 N285T probably damaging Het
Pag1 G T 3: 9,704,731 S52R probably damaging Het
Pbxip1 A G 3: 89,447,749 D525G probably benign Het
Pla2g4f A G 2: 120,304,657 F437L probably benign Het
Podn A C 4: 108,027,034 I86S probably damaging Het
Postn A G 3: 54,383,399 T676A probably benign Het
Ppp1r1c A G 2: 79,808,374 E104G probably benign Het
Prss53 T C 7: 127,887,066 T436A probably damaging Het
Psme4 A T 11: 30,838,980 E1127D probably benign Het
Ptpn18 C A 1: 34,473,392 A426E possibly damaging Het
Ptprz1 T G 6: 23,042,378 C2044G possibly damaging Het
Rad54l2 C A 9: 106,704,173 V850L probably damaging Het
Ranbp9 A G 13: 43,403,679 I28T unknown Het
Rapgef2 A T 3: 79,091,884 V527E probably damaging Het
Rere C A 4: 150,614,933 P825T unknown Het
Rundc3a A G 11: 102,400,752 T349A probably benign Het
Scn2a T C 2: 65,735,688 F1352S probably damaging Het
Senp7 T A 16: 56,123,932 C206* probably null Het
Serac1 C T 17: 6,069,383 V91I probably benign Het
Serpina1f G A 12: 103,689,791 Q393* probably null Het
Slc8a1 T C 17: 81,647,815 E598G probably damaging Het
Slmap A T 14: 26,429,858 H518Q probably benign Het
Spg11 G A 2: 122,080,300 R1199C probably damaging Het
Tada1 T C 1: 166,386,743 S104P possibly damaging Het
Tbck A G 3: 132,715,690 D186G probably damaging Het
Tdrd9 A C 12: 112,036,390 R824S possibly damaging Het
Tmem161a T C 8: 70,177,610 probably null Het
Trim55 G A 3: 19,674,507 G494D possibly damaging Het
Ttc17 T A 2: 94,406,665 M1L probably benign Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Ugt3a1 A C 15: 9,280,047 S32R probably damaging Het
Vgll3 T C 16: 65,839,457 S220P probably benign Het
Virma A G 4: 11,544,898 E1569G probably damaging Het
Vmn1r54 C G 6: 90,270,002 F299L probably benign Het
Vmn2r114 A G 17: 23,291,716 S597P probably damaging Het
Wdr7 A G 18: 63,924,847 D1249G probably damaging Het
Ypel4 A G 2: 84,737,724 Y108C probably damaging Het
Zfp770 A G 2: 114,197,285 V101A probably damaging Het
Zfyve9 A T 4: 108,718,532 C451S probably damaging Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100508724 missense probably benign 0.00
IGL00499:Cep290 APN 10 100543327 missense probably damaging 1.00
IGL00547:Cep290 APN 10 100510708 missense probably damaging 0.99
IGL00573:Cep290 APN 10 100540361 missense probably damaging 1.00
IGL00646:Cep290 APN 10 100501154 missense probably benign 0.15
IGL00755:Cep290 APN 10 100531104 missense probably damaging 1.00
IGL00835:Cep290 APN 10 100563380 nonsense probably null
IGL00846:Cep290 APN 10 100540333 splice site probably benign
IGL00985:Cep290 APN 10 100567161 splice site probably benign
IGL01687:Cep290 APN 10 100500205 missense probably damaging 1.00
IGL01782:Cep290 APN 10 100545125 nonsense probably null
IGL02010:Cep290 APN 10 100508707 missense probably benign 0.39
IGL02010:Cep290 APN 10 100561345 missense probably benign 0.00
IGL02036:Cep290 APN 10 100558100 nonsense probably null
IGL02039:Cep290 APN 10 100514602 critical splice donor site probably null
IGL02532:Cep290 APN 10 100545065 missense probably benign 0.04
IGL02950:Cep290 APN 10 100540329 splice site probably benign
IGL03105:Cep290 APN 10 100551824 missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100568088 missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100537801 missense probably benign 0.09
IGL03401:Cep290 APN 10 100500265 missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100537591 missense probably benign 0.28
R0025:Cep290 UTSW 10 100537831 missense probably damaging 1.00
R0127:Cep290 UTSW 10 100536925 splice site probably benign
R0254:Cep290 UTSW 10 100514574 missense probably benign 0.31
R0295:Cep290 UTSW 10 100537821 missense probably damaging 0.99
R0371:Cep290 UTSW 10 100518564 splice site probably benign
R0390:Cep290 UTSW 10 100508758 missense probably benign 0.09
R0399:Cep290 UTSW 10 100554400 splice site probably benign
R0413:Cep290 UTSW 10 100523314 nonsense probably null
R0427:Cep290 UTSW 10 100516179 missense probably benign 0.01
R0472:Cep290 UTSW 10 100551455 missense probably benign 0.19
R0485:Cep290 UTSW 10 100549344 missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100492676 missense probably damaging 1.00
R0675:Cep290 UTSW 10 100568813 critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100518762 missense probably benign 0.08
R1238:Cep290 UTSW 10 100517863 missense probably damaging 1.00
R1297:Cep290 UTSW 10 100539100 splice site probably benign
R1368:Cep290 UTSW 10 100494966 splice site probably benign
R1394:Cep290 UTSW 10 100537529 missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100572101 missense probably benign 0.00
R1493:Cep290 UTSW 10 100562181 missense probably benign 0.21
R1496:Cep290 UTSW 10 100538966 missense probably damaging 1.00
R1539:Cep290 UTSW 10 100496828 missense probably benign 0.06
R1598:Cep290 UTSW 10 100549329 missense probably damaging 1.00
R1616:Cep290 UTSW 10 100568836 missense probably benign
R1712:Cep290 UTSW 10 100554499 missense probably benign 0.02
R1753:Cep290 UTSW 10 100513981 missense probably benign
R1773:Cep290 UTSW 10 100510573 missense probably benign
R1775:Cep290 UTSW 10 100496810 missense probably damaging 0.98
R1799:Cep290 UTSW 10 100516196 missense probably benign 0.00
R1937:Cep290 UTSW 10 100497953 missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100531184 missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100512400 critical splice donor site probably null
R2164:Cep290 UTSW 10 100518795 missense probably damaging 0.96
R2393:Cep290 UTSW 10 100561238 critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100537437 missense probably benign 0.19
R3612:Cep290 UTSW 10 100541581 nonsense probably null
R3800:Cep290 UTSW 10 100572941 missense probably damaging 0.97
R4005:Cep290 UTSW 10 100539008 missense probably damaging 1.00
R4039:Cep290 UTSW 10 100512401 critical splice donor site probably null
R4259:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4260:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4319:Cep290 UTSW 10 100539047 missense probably benign 0.09
R4329:Cep290 UTSW 10 100537668 missense probably damaging 0.98
R4573:Cep290 UTSW 10 100518850 missense probably benign
R4614:Cep290 UTSW 10 100508740 missense probably benign
R4614:Cep290 UTSW 10 100559687 missense possibly damaging 0.93
R4708:Cep290 UTSW 10 100523264 missense probably benign 0.02
R4727:Cep290 UTSW 10 100563270 missense probably benign 0.05
R4825:Cep290 UTSW 10 100488348 missense probably damaging 0.96
R4839:Cep290 UTSW 10 100508786 missense probably damaging 0.99
R4858:Cep290 UTSW 10 100494911 missense probably benign 0.31
R4871:Cep290 UTSW 10 100548914 missense probably benign 0.22
R5094:Cep290 UTSW 10 100567030 missense probably damaging 0.97
R5103:Cep290 UTSW 10 100539020 missense probably damaging 1.00
R5499:Cep290 UTSW 10 100537653 missense probably damaging 0.99
R5505:Cep290 UTSW 10 100499186 critical splice donor site probably null
R5615:Cep290 UTSW 10 100531150 missense probably damaging 1.00
R5815:Cep290 UTSW 10 100558108 missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100523399 missense probably benign 0.44
R5889:Cep290 UTSW 10 100499074 missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100551830 missense probably damaging 0.99
R5992:Cep290 UTSW 10 100543321 missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100541787 missense probably damaging 1.00
R6213:Cep290 UTSW 10 100523360 missense probably benign 0.06
R6274:Cep290 UTSW 10 100530207 missense probably damaging 1.00
R6285:Cep290 UTSW 10 100523329 missense probably benign 0.17
R6306:Cep290 UTSW 10 100531166 missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100508776 missense probably benign 0.01
R6649:Cep290 UTSW 10 100518531 missense probably benign 0.28
R6692:Cep290 UTSW 10 100569144 splice site probably null
R6788:Cep290 UTSW 10 100488628 missense probably damaging 1.00
R6847:Cep290 UTSW 10 100563419 missense probably damaging 1.00
R6947:Cep290 UTSW 10 100530056 missense probably damaging 1.00
R7035:Cep290 UTSW 10 100499071 missense probably benign 0.07
R7073:Cep290 UTSW 10 100539003 missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100543358 missense probably damaging 0.98
R7256:Cep290 UTSW 10 100546498 missense probably damaging 1.00
R7258:Cep290 UTSW 10 100499108 missense probably benign 0.01
R7311:Cep290 UTSW 10 100537718 missense probably damaging 0.98
R7505:Cep290 UTSW 10 100516265 missense probably benign 0.01
R7615:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7643:Cep290 UTSW 10 100537553 missense probably benign
R7662:Cep290 UTSW 10 100537803 missense probably benign 0.21
R7663:Cep290 UTSW 10 100554536 critical splice donor site probably null
R7685:Cep290 UTSW 10 100540057 missense probably benign 0.19
R7699:Cep290 UTSW 10 100540369 missense probably benign 0.33
R7717:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7747:Cep290 UTSW 10 100558176 nonsense probably null
R7757:Cep290 UTSW 10 100563434 missense probably benign
R7843:Cep290 UTSW 10 100516188 missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100554490 missense probably benign
R8078:Cep290 UTSW 10 100572887 missense probably benign 0.04
R8081:Cep290 UTSW 10 100558176 nonsense probably null
R8094:Cep290 UTSW 10 100544931 missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100559671 missense probably benign 0.08
R8305:Cep290 UTSW 10 100544934 missense probably benign 0.09
R8325:Cep290 UTSW 10 100517808 missense probably benign 0.03
R8372:Cep290 UTSW 10 100549341 missense probably benign 0.00
R8443:Cep290 UTSW 10 100495844 missense possibly damaging 0.80
R8497:Cep290 UTSW 10 100551458 missense probably damaging 1.00
R8778:Cep290 UTSW 10 100514512 nonsense probably null
R8975:Cep290 UTSW 10 100513920 missense possibly damaging 0.54
R9146:Cep290 UTSW 10 100541803 missense probably benign 0.44
R9264:Cep290 UTSW 10 100498016 missense possibly damaging 0.86
R9374:Cep290 UTSW 10 100536867 missense probably damaging 0.98
R9448:Cep290 UTSW 10 100559684 missense probably benign 0.32
R9499:Cep290 UTSW 10 100536867 missense probably damaging 0.98
R9507:Cep290 UTSW 10 100494923 missense possibly damaging 0.81
R9539:Cep290 UTSW 10 100568851 missense probably damaging 1.00
R9547:Cep290 UTSW 10 100544979 missense probably benign 0.00
R9551:Cep290 UTSW 10 100536867 missense probably damaging 0.98
R9731:Cep290 UTSW 10 100510542 missense probably damaging 0.98
R9756:Cep290 UTSW 10 100516172 missense probably damaging 0.97
R9777:Cep290 UTSW 10 100518667 missense probably benign 0.01
Z1176:Cep290 UTSW 10 100549374 critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100497944 missense probably benign
Z1177:Cep290 UTSW 10 100538997 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGGCTCATGAGTGCTGATC -3'
(R):5'- CCTCATAAAGCAGTGTTGTTAGG -3'

Sequencing Primer
(F):5'- GCTCATGAGTGCTGATCATTTTC -3'
(R):5'- AAAGCAGTGTTGTTAGGAAGTTTC -3'
Posted On 2022-10-06