Incidental Mutation 'R9657:Abca13'
ID 727401
Institutional Source Beutler Lab
Gene Symbol Abca13
Ensembl Gene ENSMUSG00000004668
Gene Name ATP-binding cassette, sub-family A member 13
Synonyms A930002G16Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9657 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 9141942-9634259 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9243379 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1747 (D1747E)
Ref Sequence ENSEMBL: ENSMUSP00000040465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042740]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042740
AA Change: D1747E

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040465
Gene: ENSMUSG00000004668
AA Change: D1747E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 358 379 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 1382 1393 N/A INTRINSIC
low complexity region 1721 1737 N/A INTRINSIC
low complexity region 1859 1872 N/A INTRINSIC
Pfam:ABC2_membrane_3 3288 3740 4.7e-21 PFAM
low complexity region 3796 3809 N/A INTRINSIC
AAA 3835 4019 8.08e-12 SMART
transmembrane domain 4206 4228 N/A INTRINSIC
Pfam:ABC2_membrane_3 4317 4646 1.6e-33 PFAM
AAA 4721 4909 8.86e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.[provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(3) : Targeted(3

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T A 9: 103,953,035 (GRCm39) I88N possibly damaging Het
Atp2b4 T C 1: 133,656,478 (GRCm39) E724G probably damaging Het
Bcl2a1b T C 9: 89,081,599 (GRCm39) S63P probably damaging Het
Blzf1 T C 1: 164,134,023 (GRCm39) S9G probably benign Het
Ccdc121rt1 T C 1: 181,338,104 (GRCm39) T283A probably benign Het
Cdh22 T C 2: 164,965,715 (GRCm39) D488G probably benign Het
Cep290 A G 10: 100,351,003 (GRCm39) E688G possibly damaging Het
Cldn10 A C 14: 119,025,781 (GRCm39) E71D probably benign Het
Clip2 C T 5: 134,533,616 (GRCm39) R487Q probably benign Het
Cyp3a16 T C 5: 145,386,979 (GRCm39) D337G probably null Het
Dnah5 A T 15: 28,410,089 (GRCm39) D3654V probably damaging Het
Dock1 T C 7: 134,339,429 (GRCm39) S100P possibly damaging Het
Hdgfl2 T C 17: 56,405,978 (GRCm39) V488A unknown Het
Itih2 T C 2: 10,107,686 (GRCm39) T627A probably damaging Het
Katnip A G 7: 125,441,956 (GRCm39) S648G probably benign Het
Klhl33 T C 14: 51,134,117 (GRCm39) D144G probably benign Het
Lca5l G A 16: 95,974,953 (GRCm39) Q324* probably null Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mical2 A G 7: 111,921,806 (GRCm39) T542A probably benign Het
Moxd1 T A 10: 24,128,485 (GRCm39) V179E probably benign Het
Myh7b A G 2: 155,455,963 (GRCm39) Y116C probably damaging Het
Myoc C T 1: 162,467,229 (GRCm39) R133* probably null Het
Nol3 A T 8: 106,005,641 (GRCm39) I12F probably damaging Het
Nrap A G 19: 56,352,377 (GRCm39) V605A probably benign Het
Or5w13 T C 2: 87,524,121 (GRCm39) Y35C probably damaging Het
Or9m2 A C 2: 87,821,310 (GRCm39) N285T probably damaging Het
Pag1 G T 3: 9,769,791 (GRCm39) S52R probably damaging Het
Pbxip1 A G 3: 89,355,056 (GRCm39) D525G probably benign Het
Pla2g4f A G 2: 120,135,138 (GRCm39) F437L probably benign Het
Podn A C 4: 107,884,231 (GRCm39) I86S probably damaging Het
Postn A G 3: 54,290,820 (GRCm39) T676A probably benign Het
Ppp1r1c A G 2: 79,638,718 (GRCm39) E104G probably benign Het
Prss53 T C 7: 127,486,238 (GRCm39) T436A probably damaging Het
Psme4 A T 11: 30,788,980 (GRCm39) E1127D probably benign Het
Ptpn18 C A 1: 34,512,473 (GRCm39) A426E possibly damaging Het
Ptprz1 T G 6: 23,042,377 (GRCm39) C2044G possibly damaging Het
Rad54l2 C A 9: 106,581,372 (GRCm39) V850L probably damaging Het
Ranbp9 A G 13: 43,557,155 (GRCm39) I28T unknown Het
Rapgef2 A T 3: 78,999,191 (GRCm39) V527E probably damaging Het
Rere C A 4: 150,699,390 (GRCm39) P825T unknown Het
Rundc3a A G 11: 102,291,578 (GRCm39) T349A probably benign Het
Scn2a T C 2: 65,566,032 (GRCm39) F1352S probably damaging Het
Senp7 T A 16: 55,944,295 (GRCm39) C206* probably null Het
Serac1 C T 17: 6,119,658 (GRCm39) V91I probably benign Het
Serpina1f G A 12: 103,656,050 (GRCm39) Q393* probably null Het
Slc8a1 T C 17: 81,955,244 (GRCm39) E598G probably damaging Het
Slmap A T 14: 26,151,013 (GRCm39) H518Q probably benign Het
Spg11 G A 2: 121,910,781 (GRCm39) R1199C probably damaging Het
Tada1 T C 1: 166,214,312 (GRCm39) S104P possibly damaging Het
Tbck A G 3: 132,421,451 (GRCm39) D186G probably damaging Het
Tdrd9 A C 12: 112,002,824 (GRCm39) R824S possibly damaging Het
Tmem161a T C 8: 70,630,260 (GRCm39) probably null Het
Trim55 G A 3: 19,728,671 (GRCm39) G494D possibly damaging Het
Ttc17 T A 2: 94,237,010 (GRCm39) M1L probably benign Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Ugt3a1 A C 15: 9,280,133 (GRCm39) S32R probably damaging Het
Vgll3 T C 16: 65,636,343 (GRCm39) S220P probably benign Het
Virma A G 4: 11,544,898 (GRCm39) E1569G probably damaging Het
Vmn1r54 C G 6: 90,246,984 (GRCm39) F299L probably benign Het
Vmn2r114 A G 17: 23,510,690 (GRCm39) S597P probably damaging Het
Wdr7 A G 18: 64,057,918 (GRCm39) D1249G probably damaging Het
Wdr97 A G 15: 76,245,476 (GRCm39) Y1271C Het
Yju2b T C 8: 84,987,084 (GRCm39) K138E possibly damaging Het
Ypel4 A G 2: 84,568,068 (GRCm39) Y108C probably damaging Het
Zfp770 A G 2: 114,027,766 (GRCm39) V101A probably damaging Het
Zfyve9 A T 4: 108,575,729 (GRCm39) C451S probably damaging Het
Other mutations in Abca13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Abca13 APN 11 9,247,443 (GRCm39) missense probably benign 0.24
IGL00481:Abca13 APN 11 9,240,969 (GRCm39) missense probably damaging 0.99
IGL00707:Abca13 APN 11 9,241,586 (GRCm39) missense probably damaging 0.99
IGL00755:Abca13 APN 11 9,492,102 (GRCm39) missense possibly damaging 0.87
IGL00771:Abca13 APN 11 9,240,870 (GRCm39) missense probably damaging 1.00
IGL00802:Abca13 APN 11 9,247,717 (GRCm39) missense probably damaging 0.96
IGL00807:Abca13 APN 11 9,328,285 (GRCm39) missense probably benign 0.10
IGL00977:Abca13 APN 11 9,349,284 (GRCm39) missense probably damaging 1.00
IGL01064:Abca13 APN 11 9,433,855 (GRCm39) missense probably benign 0.01
IGL01100:Abca13 APN 11 9,224,673 (GRCm39) splice site probably null
IGL01290:Abca13 APN 11 9,206,232 (GRCm39) missense probably damaging 1.00
IGL01299:Abca13 APN 11 9,248,743 (GRCm39) missense probably benign 0.22
IGL01302:Abca13 APN 11 9,349,470 (GRCm39) splice site probably benign
IGL01307:Abca13 APN 11 9,247,159 (GRCm39) missense possibly damaging 0.86
IGL01349:Abca13 APN 11 9,242,076 (GRCm39) missense probably benign 0.05
IGL01351:Abca13 APN 11 9,217,565 (GRCm39) missense probably benign 0.28
IGL01446:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01453:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01461:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01476:Abca13 APN 11 9,353,834 (GRCm39) missense probably damaging 0.97
IGL01506:Abca13 APN 11 9,247,447 (GRCm39) missense probably benign 0.36
IGL01527:Abca13 APN 11 9,240,788 (GRCm39) missense possibly damaging 0.49
IGL01559:Abca13 APN 11 9,259,020 (GRCm39) missense possibly damaging 0.82
IGL01580:Abca13 APN 11 9,243,527 (GRCm39) missense probably benign 0.00
IGL01679:Abca13 APN 11 9,248,071 (GRCm39) missense probably benign 0.07
IGL01731:Abca13 APN 11 9,199,749 (GRCm39) splice site probably benign
IGL01762:Abca13 APN 11 9,265,423 (GRCm39) missense probably benign 0.18
IGL01781:Abca13 APN 11 9,349,280 (GRCm39) missense probably damaging 1.00
IGL01802:Abca13 APN 11 9,242,438 (GRCm39) missense probably benign 0.00
IGL01809:Abca13 APN 11 9,240,339 (GRCm39) missense probably damaging 0.96
IGL01906:Abca13 APN 11 9,166,225 (GRCm39) missense probably damaging 1.00
IGL01928:Abca13 APN 11 9,633,342 (GRCm39) missense probably benign 0.13
IGL01940:Abca13 APN 11 9,517,661 (GRCm39) splice site probably benign
IGL01993:Abca13 APN 11 9,208,452 (GRCm39) unclassified probably benign
IGL02039:Abca13 APN 11 9,247,193 (GRCm39) nonsense probably null
IGL02159:Abca13 APN 11 9,264,545 (GRCm39) missense probably benign 0.00
IGL02202:Abca13 APN 11 9,238,529 (GRCm39) missense possibly damaging 0.55
IGL02268:Abca13 APN 11 9,240,626 (GRCm39) missense probably benign 0.00
IGL02332:Abca13 APN 11 9,241,482 (GRCm39) missense probably damaging 0.98
IGL02380:Abca13 APN 11 9,241,599 (GRCm39) missense possibly damaging 0.73
IGL02466:Abca13 APN 11 9,247,527 (GRCm39) missense probably benign 0.00
IGL02505:Abca13 APN 11 9,531,498 (GRCm39) missense probably damaging 1.00
IGL02507:Abca13 APN 11 9,349,388 (GRCm39) missense probably damaging 1.00
IGL02558:Abca13 APN 11 9,349,387 (GRCm39) missense probably damaging 1.00
IGL02581:Abca13 APN 11 9,349,132 (GRCm39) splice site probably benign
IGL02586:Abca13 APN 11 9,243,983 (GRCm39) missense possibly damaging 0.56
IGL02598:Abca13 APN 11 9,381,898 (GRCm39) missense probably damaging 1.00
IGL02747:Abca13 APN 11 9,323,282 (GRCm39) nonsense probably null
IGL02893:Abca13 APN 11 9,240,543 (GRCm39) missense probably damaging 0.96
IGL02930:Abca13 APN 11 9,328,226 (GRCm39) missense possibly damaging 0.86
IGL02967:Abca13 APN 11 9,328,291 (GRCm39) missense probably damaging 0.99
IGL02983:Abca13 APN 11 9,240,663 (GRCm39) missense probably benign 0.40
IGL02999:Abca13 APN 11 9,531,757 (GRCm39) splice site probably benign
IGL03100:Abca13 APN 11 9,208,527 (GRCm39) missense probably benign 0.25
IGL03114:Abca13 APN 11 9,478,999 (GRCm39) missense probably benign 0.06
IGL03230:Abca13 APN 11 9,244,313 (GRCm39) missense probably benign 0.02
IGL03329:Abca13 APN 11 9,248,047 (GRCm39) missense probably benign 0.08
IGL03380:Abca13 APN 11 9,248,574 (GRCm39) missense probably benign 0.10
IGL02835:Abca13 UTSW 11 9,401,515 (GRCm39) missense probably damaging 1.00
PIT4366001:Abca13 UTSW 11 9,244,962 (GRCm39) missense probably benign
PIT4458001:Abca13 UTSW 11 9,248,304 (GRCm39) missense probably benign 0.05
R0017:Abca13 UTSW 11 9,242,775 (GRCm39) missense probably damaging 0.99
R0079:Abca13 UTSW 11 9,243,493 (GRCm39) missense probably benign 0.00
R0089:Abca13 UTSW 11 9,242,886 (GRCm39) missense possibly damaging 0.76
R0103:Abca13 UTSW 11 9,223,951 (GRCm39) missense probably damaging 1.00
R0103:Abca13 UTSW 11 9,223,951 (GRCm39) missense probably damaging 1.00
R0113:Abca13 UTSW 11 9,242,114 (GRCm39) missense possibly damaging 0.54
R0119:Abca13 UTSW 11 9,248,076 (GRCm39) missense probably benign 0.03
R0152:Abca13 UTSW 11 9,531,724 (GRCm39) missense probably damaging 0.98
R0255:Abca13 UTSW 11 9,531,545 (GRCm39) missense probably damaging 1.00
R0277:Abca13 UTSW 11 9,244,701 (GRCm39) missense probably benign 0.25
R0278:Abca13 UTSW 11 9,328,215 (GRCm39) missense probably damaging 1.00
R0294:Abca13 UTSW 11 9,219,122 (GRCm39) splice site probably null
R0299:Abca13 UTSW 11 9,248,076 (GRCm39) missense probably benign 0.03
R0310:Abca13 UTSW 11 9,243,810 (GRCm39) missense probably benign 0.36
R0317:Abca13 UTSW 11 9,243,459 (GRCm39) missense probably damaging 1.00
R0323:Abca13 UTSW 11 9,244,701 (GRCm39) missense probably benign 0.25
R0324:Abca13 UTSW 11 9,247,669 (GRCm39) missense possibly damaging 0.76
R0329:Abca13 UTSW 11 9,349,430 (GRCm39) missense probably damaging 0.97
R0336:Abca13 UTSW 11 9,248,481 (GRCm39) missense probably benign 0.04
R0346:Abca13 UTSW 11 9,516,278 (GRCm39) missense probably damaging 0.99
R0380:Abca13 UTSW 11 9,538,500 (GRCm39) splice site probably null
R0382:Abca13 UTSW 11 9,586,650 (GRCm39) splice site probably benign
R0482:Abca13 UTSW 11 9,278,207 (GRCm39) missense possibly damaging 0.88
R0487:Abca13 UTSW 11 9,281,687 (GRCm39) missense probably benign 0.07
R0491:Abca13 UTSW 11 9,248,235 (GRCm39) missense probably benign 0.02
R0496:Abca13 UTSW 11 9,241,701 (GRCm39) missense probably benign 0.01
R0505:Abca13 UTSW 11 9,241,058 (GRCm39) missense probably benign 0.00
R0511:Abca13 UTSW 11 9,244,559 (GRCm39) missense probably benign
R0525:Abca13 UTSW 11 9,243,371 (GRCm39) missense probably damaging 1.00
R0538:Abca13 UTSW 11 9,217,622 (GRCm39) critical splice donor site probably null
R0615:Abca13 UTSW 11 9,206,197 (GRCm39) missense probably damaging 0.96
R0634:Abca13 UTSW 11 9,264,491 (GRCm39) missense possibly damaging 0.59
R0699:Abca13 UTSW 11 9,538,508 (GRCm39) splice site probably benign
R0848:Abca13 UTSW 11 9,632,011 (GRCm39) nonsense probably null
R0883:Abca13 UTSW 11 9,241,238 (GRCm39) nonsense probably null
R0892:Abca13 UTSW 11 9,248,305 (GRCm39) missense probably benign 0.00
R0904:Abca13 UTSW 11 9,248,740 (GRCm39) missense probably benign 0.22
R0968:Abca13 UTSW 11 9,248,016 (GRCm39) missense probably benign 0.00
R1187:Abca13 UTSW 11 9,478,981 (GRCm39) missense probably benign 0.00
R1299:Abca13 UTSW 11 9,244,821 (GRCm39) missense possibly damaging 0.94
R1323:Abca13 UTSW 11 9,240,937 (GRCm39) missense possibly damaging 0.86
R1323:Abca13 UTSW 11 9,240,937 (GRCm39) missense possibly damaging 0.86
R1368:Abca13 UTSW 11 9,241,836 (GRCm39) missense probably benign
R1387:Abca13 UTSW 11 9,632,085 (GRCm39) nonsense probably null
R1436:Abca13 UTSW 11 9,242,646 (GRCm39) missense probably damaging 0.99
R1449:Abca13 UTSW 11 9,248,580 (GRCm39) missense probably damaging 1.00
R1450:Abca13 UTSW 11 9,380,531 (GRCm39) splice site probably benign
R1462:Abca13 UTSW 11 9,433,924 (GRCm39) splice site probably benign
R1465:Abca13 UTSW 11 9,349,303 (GRCm39) missense probably damaging 1.00
R1465:Abca13 UTSW 11 9,349,303 (GRCm39) missense probably damaging 1.00
R1466:Abca13 UTSW 11 9,520,536 (GRCm39) splice site probably benign
R1494:Abca13 UTSW 11 9,416,429 (GRCm39) nonsense probably null
R1559:Abca13 UTSW 11 9,349,180 (GRCm39) missense probably null 1.00
R1564:Abca13 UTSW 11 9,384,316 (GRCm39) nonsense probably null
R1698:Abca13 UTSW 11 9,264,507 (GRCm39) missense probably benign 0.13
R1728:Abca13 UTSW 11 9,199,680 (GRCm39) missense probably benign 0.02
R1734:Abca13 UTSW 11 9,535,460 (GRCm39) missense probably benign 0.03
R1781:Abca13 UTSW 11 9,219,194 (GRCm39) missense probably damaging 1.00
R1782:Abca13 UTSW 11 9,247,971 (GRCm39) missense probably benign 0.36
R1807:Abca13 UTSW 11 9,241,755 (GRCm39) missense probably damaging 0.98
R1830:Abca13 UTSW 11 9,240,350 (GRCm39) missense probably benign 0.04
R1869:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1870:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1871:Abca13 UTSW 11 9,242,134 (GRCm39) missense probably benign 0.19
R1903:Abca13 UTSW 11 9,416,411 (GRCm39) missense probably benign 0.13
R1916:Abca13 UTSW 11 9,484,456 (GRCm39) missense probably damaging 1.00
R1936:Abca13 UTSW 11 9,243,595 (GRCm39) missense probably benign 0.13
R1976:Abca13 UTSW 11 9,347,815 (GRCm39) missense probably damaging 1.00
R2001:Abca13 UTSW 11 9,223,967 (GRCm39) missense probably benign 0.01
R2007:Abca13 UTSW 11 9,141,987 (GRCm39) missense probably benign 0.19
R2016:Abca13 UTSW 11 9,240,619 (GRCm39) missense probably damaging 1.00
R2017:Abca13 UTSW 11 9,240,619 (GRCm39) missense probably damaging 1.00
R2034:Abca13 UTSW 11 9,242,628 (GRCm39) missense possibly damaging 0.83
R2051:Abca13 UTSW 11 9,278,098 (GRCm39) missense probably benign 0.04
R2075:Abca13 UTSW 11 9,472,382 (GRCm39) missense probably damaging 1.00
R2118:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2120:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2124:Abca13 UTSW 11 9,259,013 (GRCm39) splice site probably benign
R2148:Abca13 UTSW 11 9,565,764 (GRCm39) missense probably damaging 1.00
R2149:Abca13 UTSW 11 9,217,508 (GRCm39) missense possibly damaging 0.68
R2157:Abca13 UTSW 11 9,527,170 (GRCm39) missense probably damaging 0.97
R2167:Abca13 UTSW 11 9,238,532 (GRCm39) missense probably benign 0.19
R2261:Abca13 UTSW 11 9,242,288 (GRCm39) missense probably benign
R2263:Abca13 UTSW 11 9,224,702 (GRCm39) missense probably benign 0.04
R2281:Abca13 UTSW 11 9,278,136 (GRCm39) missense probably damaging 0.98
R2340:Abca13 UTSW 11 9,349,165 (GRCm39) missense probably damaging 0.99
R2357:Abca13 UTSW 11 9,247,336 (GRCm39) missense probably damaging 1.00
R2370:Abca13 UTSW 11 9,206,185 (GRCm39) missense possibly damaging 0.85
R2384:Abca13 UTSW 11 9,217,450 (GRCm39) splice site probably benign
R2393:Abca13 UTSW 11 9,225,057 (GRCm39) nonsense probably null
R2432:Abca13 UTSW 11 9,401,333 (GRCm39) splice site probably benign
R2446:Abca13 UTSW 11 9,225,101 (GRCm39) missense probably benign
R2568:Abca13 UTSW 11 9,283,310 (GRCm39) missense probably benign 0.40
R2847:Abca13 UTSW 11 9,244,584 (GRCm39) missense possibly damaging 0.59
R2860:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2861:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2862:Abca13 UTSW 11 9,259,057 (GRCm39) missense probably damaging 0.99
R2877:Abca13 UTSW 11 9,241,889 (GRCm39) missense possibly damaging 0.91
R2878:Abca13 UTSW 11 9,241,889 (GRCm39) missense possibly damaging 0.91
R3748:Abca13 UTSW 11 9,266,119 (GRCm39) splice site probably benign
R3789:Abca13 UTSW 11 9,460,668 (GRCm39) missense probably damaging 0.97
R3933:Abca13 UTSW 11 9,304,856 (GRCm39) missense probably damaging 1.00
R3981:Abca13 UTSW 11 9,482,407 (GRCm39) missense probably benign
R4002:Abca13 UTSW 11 9,535,415 (GRCm39) missense probably benign 0.00
R4010:Abca13 UTSW 11 9,572,013 (GRCm39) splice site probably benign
R4011:Abca13 UTSW 11 9,572,013 (GRCm39) splice site probably benign
R4127:Abca13 UTSW 11 9,141,973 (GRCm39) missense probably benign 0.00
R4214:Abca13 UTSW 11 9,243,877 (GRCm39) missense probably damaging 0.96
R4236:Abca13 UTSW 11 9,206,205 (GRCm39) missense probably damaging 1.00
R4237:Abca13 UTSW 11 9,384,188 (GRCm39) missense probably benign 0.01
R4359:Abca13 UTSW 11 9,247,629 (GRCm39) missense probably benign 0.02
R4378:Abca13 UTSW 11 9,243,644 (GRCm39) missense probably benign 0.00
R4389:Abca13 UTSW 11 9,247,878 (GRCm39) missense probably damaging 0.98
R4392:Abca13 UTSW 11 9,259,034 (GRCm39) missense possibly damaging 0.94
R4623:Abca13 UTSW 11 9,259,130 (GRCm39) missense probably damaging 1.00
R4684:Abca13 UTSW 11 9,384,193 (GRCm39) nonsense probably null
R4691:Abca13 UTSW 11 9,384,195 (GRCm39) missense probably damaging 1.00
R4700:Abca13 UTSW 11 9,242,306 (GRCm39) missense possibly damaging 0.59
R4701:Abca13 UTSW 11 9,242,306 (GRCm39) missense possibly damaging 0.59
R4704:Abca13 UTSW 11 9,226,990 (GRCm39) missense possibly damaging 0.94
R4751:Abca13 UTSW 11 9,227,973 (GRCm39) critical splice donor site probably null
R4772:Abca13 UTSW 11 9,265,339 (GRCm39) splice site probably null
R4782:Abca13 UTSW 11 9,278,096 (GRCm39) missense probably damaging 0.96
R4801:Abca13 UTSW 11 9,472,341 (GRCm39) missense possibly damaging 0.94
R4802:Abca13 UTSW 11 9,472,341 (GRCm39) missense possibly damaging 0.94
R4819:Abca13 UTSW 11 9,240,421 (GRCm39) missense possibly damaging 0.88
R4831:Abca13 UTSW 11 9,492,077 (GRCm39) nonsense probably null
R4851:Abca13 UTSW 11 9,433,890 (GRCm39) missense probably benign 0.02
R4857:Abca13 UTSW 11 9,244,143 (GRCm39) missense probably benign 0.22
R4869:Abca13 UTSW 11 9,265,434 (GRCm39) splice site probably null
R4982:Abca13 UTSW 11 9,242,348 (GRCm39) missense possibly damaging 0.58
R5031:Abca13 UTSW 11 9,247,678 (GRCm39) missense probably damaging 0.99
R5044:Abca13 UTSW 11 9,323,323 (GRCm39) missense possibly damaging 0.80
R5092:Abca13 UTSW 11 9,208,535 (GRCm39) missense probably damaging 1.00
R5155:Abca13 UTSW 11 9,482,447 (GRCm39) missense probably damaging 0.98
R5173:Abca13 UTSW 11 9,632,032 (GRCm39) frame shift probably null
R5180:Abca13 UTSW 11 9,416,510 (GRCm39) missense probably benign 0.01
R5244:Abca13 UTSW 11 9,225,081 (GRCm39) missense probably benign 0.28
R5257:Abca13 UTSW 11 9,199,684 (GRCm39) missense possibly damaging 0.94
R5258:Abca13 UTSW 11 9,199,684 (GRCm39) missense possibly damaging 0.94
R5299:Abca13 UTSW 11 9,381,861 (GRCm39) missense probably damaging 1.00
R5363:Abca13 UTSW 11 9,227,035 (GRCm39) missense possibly damaging 0.75
R5365:Abca13 UTSW 11 9,578,629 (GRCm39) missense probably damaging 1.00
R5419:Abca13 UTSW 11 9,143,533 (GRCm39) critical splice donor site probably null
R5426:Abca13 UTSW 11 9,240,722 (GRCm39) missense probably damaging 1.00
R5468:Abca13 UTSW 11 9,244,062 (GRCm39) missense probably damaging 1.00
R5477:Abca13 UTSW 11 9,251,298 (GRCm39) missense possibly damaging 0.49
R5541:Abca13 UTSW 11 9,241,545 (GRCm39) missense probably benign 0.00
R5553:Abca13 UTSW 11 9,278,158 (GRCm39) missense probably damaging 1.00
R5556:Abca13 UTSW 11 9,208,546 (GRCm39) missense possibly damaging 0.91
R5566:Abca13 UTSW 11 9,244,615 (GRCm39) nonsense probably null
R5582:Abca13 UTSW 11 9,586,639 (GRCm39) splice site probably null
R5604:Abca13 UTSW 11 9,516,279 (GRCm39) missense probably damaging 0.97
R5609:Abca13 UTSW 11 9,353,874 (GRCm39) missense probably benign 0.01
R5617:Abca13 UTSW 11 9,227,891 (GRCm39) missense probably benign 0.00
R5693:Abca13 UTSW 11 9,266,233 (GRCm39) missense probably benign 0.29
R5707:Abca13 UTSW 11 9,460,620 (GRCm39) missense probably damaging 1.00
R5725:Abca13 UTSW 11 9,527,181 (GRCm39) missense probably benign 0.00
R5728:Abca13 UTSW 11 9,520,576 (GRCm39) missense probably damaging 1.00
R5738:Abca13 UTSW 11 9,571,917 (GRCm39) missense probably damaging 1.00
R5758:Abca13 UTSW 11 9,264,536 (GRCm39) missense probably damaging 0.97
R5762:Abca13 UTSW 11 9,531,665 (GRCm39) missense probably damaging 1.00
R5771:Abca13 UTSW 11 9,241,411 (GRCm39) missense probably damaging 1.00
R5809:Abca13 UTSW 11 9,243,692 (GRCm39) missense probably damaging 1.00
R5826:Abca13 UTSW 11 9,632,056 (GRCm39) missense probably damaging 0.99
R5831:Abca13 UTSW 11 9,517,777 (GRCm39) nonsense probably null
R5834:Abca13 UTSW 11 9,227,974 (GRCm39) critical splice donor site probably null
R5902:Abca13 UTSW 11 9,247,177 (GRCm39) missense probably damaging 1.00
R5933:Abca13 UTSW 11 9,199,658 (GRCm39) missense possibly damaging 0.63
R5945:Abca13 UTSW 11 9,243,398 (GRCm39) missense probably benign 0.04
R5969:Abca13 UTSW 11 9,242,214 (GRCm39) nonsense probably null
R5985:Abca13 UTSW 11 9,241,628 (GRCm39) missense probably benign 0.02
R5998:Abca13 UTSW 11 9,517,708 (GRCm39) missense probably damaging 0.97
R6021:Abca13 UTSW 11 9,240,465 (GRCm39) nonsense probably null
R6022:Abca13 UTSW 11 9,240,759 (GRCm39) missense probably damaging 1.00
R6032:Abca13 UTSW 11 9,247,752 (GRCm39) missense possibly damaging 0.52
R6032:Abca13 UTSW 11 9,247,752 (GRCm39) missense possibly damaging 0.52
R6105:Abca13 UTSW 11 9,347,812 (GRCm39) missense probably damaging 1.00
R6153:Abca13 UTSW 11 9,251,259 (GRCm39) critical splice acceptor site probably null
R6162:Abca13 UTSW 11 9,259,047 (GRCm39) missense probably damaging 1.00
R6187:Abca13 UTSW 11 9,259,085 (GRCm39) missense probably damaging 1.00
R6247:Abca13 UTSW 11 9,353,874 (GRCm39) missense probably benign 0.01
R6329:Abca13 UTSW 11 9,227,937 (GRCm39) missense probably damaging 1.00
R6352:Abca13 UTSW 11 9,259,139 (GRCm39) splice site probably null
R6367:Abca13 UTSW 11 9,166,248 (GRCm39) missense possibly damaging 0.85
R6423:Abca13 UTSW 11 9,248,778 (GRCm39) missense probably benign 0.01
R6424:Abca13 UTSW 11 9,460,542 (GRCm39) missense probably benign
R6456:Abca13 UTSW 11 9,240,474 (GRCm39) missense possibly damaging 0.94
R6490:Abca13 UTSW 11 9,248,661 (GRCm39) missense probably benign 0.00
R6547:Abca13 UTSW 11 9,224,757 (GRCm39) missense probably benign 0.04
R6594:Abca13 UTSW 11 9,244,632 (GRCm39) missense possibly damaging 0.52
R6604:Abca13 UTSW 11 9,328,384 (GRCm39) missense probably damaging 1.00
R6614:Abca13 UTSW 11 9,244,371 (GRCm39) missense probably benign 0.04
R6736:Abca13 UTSW 11 9,415,058 (GRCm39) missense probably damaging 1.00
R6742:Abca13 UTSW 11 9,278,168 (GRCm39) missense probably damaging 1.00
R6791:Abca13 UTSW 11 9,328,504 (GRCm39) missense probably damaging 1.00
R6834:Abca13 UTSW 11 9,225,110 (GRCm39) missense possibly damaging 0.48
R6936:Abca13 UTSW 11 9,248,568 (GRCm39) missense probably damaging 0.96
R6955:Abca13 UTSW 11 9,244,307 (GRCm39) missense probably benign 0.28
R7031:Abca13 UTSW 11 9,571,892 (GRCm39) missense probably damaging 1.00
R7065:Abca13 UTSW 11 9,242,595 (GRCm39) missense probably benign 0.02
R7067:Abca13 UTSW 11 9,241,845 (GRCm39) missense probably benign 0.14
R7070:Abca13 UTSW 11 9,240,701 (GRCm39) missense probably benign 0.06
R7094:Abca13 UTSW 11 9,248,610 (GRCm39) missense probably damaging 0.96
R7102:Abca13 UTSW 11 9,285,215 (GRCm39) missense probably damaging 1.00
R7105:Abca13 UTSW 11 9,347,842 (GRCm39) missense probably damaging 1.00
R7131:Abca13 UTSW 11 9,241,893 (GRCm39) missense probably benign 0.37
R7155:Abca13 UTSW 11 9,479,010 (GRCm39) missense probably benign
R7158:Abca13 UTSW 11 9,223,982 (GRCm39) missense probably benign
R7212:Abca13 UTSW 11 9,248,854 (GRCm39) missense probably benign 0.04
R7215:Abca13 UTSW 11 9,238,405 (GRCm39) splice site probably null
R7228:Abca13 UTSW 11 9,247,653 (GRCm39) missense probably benign
R7231:Abca13 UTSW 11 9,244,175 (GRCm39) missense probably benign 0.25
R7247:Abca13 UTSW 11 9,240,732 (GRCm39) missense probably benign 0.00
R7278:Abca13 UTSW 11 9,241,126 (GRCm39) missense possibly damaging 0.56
R7299:Abca13 UTSW 11 9,244,649 (GRCm39) missense probably damaging 0.98
R7304:Abca13 UTSW 11 9,247,203 (GRCm39) missense probably benign
R7328:Abca13 UTSW 11 9,241,545 (GRCm39) missense probably benign 0.14
R7374:Abca13 UTSW 11 9,242,136 (GRCm39) missense possibly damaging 0.46
R7376:Abca13 UTSW 11 9,241,118 (GRCm39) missense probably benign 0.00
R7384:Abca13 UTSW 11 9,283,257 (GRCm39) missense probably damaging 1.00
R7395:Abca13 UTSW 11 9,241,658 (GRCm39) missense probably benign 0.01
R7419:Abca13 UTSW 11 9,247,833 (GRCm39) missense probably damaging 1.00
R7419:Abca13 UTSW 11 9,226,959 (GRCm39) missense probably damaging 1.00
R7421:Abca13 UTSW 11 9,460,463 (GRCm39) missense probably benign
R7458:Abca13 UTSW 11 9,240,777 (GRCm39) missense possibly damaging 0.94
R7474:Abca13 UTSW 11 9,278,088 (GRCm39) nonsense probably null
R7492:Abca13 UTSW 11 9,243,167 (GRCm39) missense probably benign 0.08
R7660:Abca13 UTSW 11 9,240,678 (GRCm39) missense probably benign 0.00
R7677:Abca13 UTSW 11 9,248,349 (GRCm39) nonsense probably null
R7744:Abca13 UTSW 11 9,240,421 (GRCm39) missense possibly damaging 0.88
R7790:Abca13 UTSW 11 9,247,915 (GRCm39) missense probably damaging 1.00
R7798:Abca13 UTSW 11 9,241,664 (GRCm39) missense probably benign 0.04
R7811:Abca13 UTSW 11 9,527,141 (GRCm39) splice site probably null
R7831:Abca13 UTSW 11 9,247,404 (GRCm39) missense possibly damaging 0.46
R7867:Abca13 UTSW 11 9,212,139 (GRCm39) critical splice donor site probably null
R7910:Abca13 UTSW 11 9,531,590 (GRCm39) missense probably damaging 1.00
R7964:Abca13 UTSW 11 9,266,146 (GRCm39) missense probably benign 0.06
R8037:Abca13 UTSW 11 9,243,904 (GRCm39) missense probably damaging 1.00
R8049:Abca13 UTSW 11 9,241,867 (GRCm39) missense probably damaging 0.99
R8059:Abca13 UTSW 11 9,323,279 (GRCm39) missense probably benign 0.00
R8072:Abca13 UTSW 11 9,244,574 (GRCm39) missense probably benign 0.10
R8078:Abca13 UTSW 11 9,251,279 (GRCm39) missense probably benign 0.32
R8112:Abca13 UTSW 11 9,264,624 (GRCm39) missense probably benign 0.01
R8146:Abca13 UTSW 11 9,347,829 (GRCm39) missense probably damaging 1.00
R8164:Abca13 UTSW 11 9,565,799 (GRCm39) missense probably damaging 1.00
R8195:Abca13 UTSW 11 9,224,735 (GRCm39) missense probably benign 0.00
R8220:Abca13 UTSW 11 9,384,299 (GRCm39) missense possibly damaging 0.58
R8235:Abca13 UTSW 11 9,212,077 (GRCm39) missense probably damaging 0.99
R8307:Abca13 UTSW 11 9,227,922 (GRCm39) nonsense probably null
R8310:Abca13 UTSW 11 9,328,269 (GRCm39) missense possibly damaging 0.90
R8315:Abca13 UTSW 11 9,535,502 (GRCm39) missense probably benign 0.44
R8315:Abca13 UTSW 11 9,328,460 (GRCm39) missense probably null 1.00
R8324:Abca13 UTSW 11 9,240,395 (GRCm39) missense probably damaging 1.00
R8375:Abca13 UTSW 11 9,347,841 (GRCm39) missense probably damaging 1.00
R8375:Abca13 UTSW 11 9,265,416 (GRCm39) missense probably benign 0.00
R8400:Abca13 UTSW 11 9,248,218 (GRCm39) missense probably damaging 0.97
R8400:Abca13 UTSW 11 9,243,925 (GRCm39) missense probably benign 0.00
R8425:Abca13 UTSW 11 9,264,623 (GRCm39) missense possibly damaging 0.92
R8486:Abca13 UTSW 11 9,225,092 (GRCm39) missense probably benign 0.00
R8493:Abca13 UTSW 11 9,460,668 (GRCm39) missense probably damaging 0.97
R8502:Abca13 UTSW 11 9,219,282 (GRCm39) missense probably benign 0.02
R8716:Abca13 UTSW 11 9,243,774 (GRCm39) missense probably benign 0.09
R8787:Abca13 UTSW 11 9,225,053 (GRCm39) missense possibly damaging 0.92
R8829:Abca13 UTSW 11 9,571,881 (GRCm39) missense probably damaging 1.00
R8859:Abca13 UTSW 11 9,328,397 (GRCm39) missense
R8871:Abca13 UTSW 11 9,248,071 (GRCm39) missense probably benign 0.07
R8883:Abca13 UTSW 11 9,283,168 (GRCm39) missense probably benign 0.00
R8919:Abca13 UTSW 11 9,241,653 (GRCm39) missense possibly damaging 0.84
R8966:Abca13 UTSW 11 9,578,588 (GRCm39) missense probably damaging 1.00
R8967:Abca13 UTSW 11 9,242,696 (GRCm39) missense probably benign 0.18
R8969:Abca13 UTSW 11 9,227,944 (GRCm39) missense probably benign
R8972:Abca13 UTSW 11 9,278,138 (GRCm39) missense probably damaging 1.00
R9002:Abca13 UTSW 11 9,241,926 (GRCm39) missense possibly damaging 0.94
R9046:Abca13 UTSW 11 9,243,525 (GRCm39) missense probably benign 0.04
R9051:Abca13 UTSW 11 9,285,232 (GRCm39) missense probably damaging 1.00
R9056:Abca13 UTSW 11 9,414,921 (GRCm39) missense probably damaging 1.00
R9061:Abca13 UTSW 11 9,227,847 (GRCm39) missense probably benign 0.02
R9072:Abca13 UTSW 11 9,240,834 (GRCm39) missense possibly damaging 0.93
R9090:Abca13 UTSW 11 9,241,698 (GRCm39) missense probably damaging 0.98
R9127:Abca13 UTSW 11 9,242,080 (GRCm39) missense probably benign 0.03
R9164:Abca13 UTSW 11 9,278,157 (GRCm39) missense probably damaging 1.00
R9175:Abca13 UTSW 11 9,531,593 (GRCm39) missense probably damaging 0.98
R9190:Abca13 UTSW 11 9,241,886 (GRCm39) missense probably damaging 0.96
R9244:Abca13 UTSW 11 9,241,577 (GRCm39) missense probably benign 0.01
R9255:Abca13 UTSW 11 9,278,213 (GRCm39) missense probably damaging 1.00
R9271:Abca13 UTSW 11 9,241,698 (GRCm39) missense probably damaging 0.98
R9321:Abca13 UTSW 11 9,460,475 (GRCm39) missense probably benign 0.00
R9356:Abca13 UTSW 11 9,206,305 (GRCm39) missense probably benign 0.11
R9369:Abca13 UTSW 11 9,328,444 (GRCm39) missense probably damaging 1.00
R9423:Abca13 UTSW 11 9,240,395 (GRCm39) missense probably damaging 1.00
R9432:Abca13 UTSW 11 9,244,559 (GRCm39) missense probably benign 0.00
R9455:Abca13 UTSW 11 9,353,897 (GRCm39) missense probably damaging 1.00
R9486:Abca13 UTSW 11 9,240,621 (GRCm39) missense possibly damaging 0.88
R9492:Abca13 UTSW 11 9,243,667 (GRCm39) nonsense probably null
R9511:Abca13 UTSW 11 9,278,130 (GRCm39) missense probably benign 0.16
R9545:Abca13 UTSW 11 9,416,538 (GRCm39) missense probably damaging 1.00
R9566:Abca13 UTSW 11 9,414,927 (GRCm39) missense probably damaging 1.00
R9609:Abca13 UTSW 11 9,208,549 (GRCm39) missense probably damaging 1.00
R9616:Abca13 UTSW 11 9,240,501 (GRCm39) missense probably benign 0.00
R9651:Abca13 UTSW 11 9,535,484 (GRCm39) missense probably benign
R9651:Abca13 UTSW 11 9,243,741 (GRCm39) missense probably benign 0.31
R9653:Abca13 UTSW 11 9,243,741 (GRCm39) missense probably benign 0.31
R9684:Abca13 UTSW 11 9,283,307 (GRCm39) missense probably damaging 1.00
X0013:Abca13 UTSW 11 9,223,899 (GRCm39) missense probably benign 0.02
X0057:Abca13 UTSW 11 9,244,744 (GRCm39) missense probably damaging 0.96
X0066:Abca13 UTSW 11 9,217,565 (GRCm39) missense probably damaging 0.96
Z1088:Abca13 UTSW 11 9,244,687 (GRCm39) missense probably damaging 0.99
Z1176:Abca13 UTSW 11 9,217,461 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,201,376 (GRCm39) missense possibly damaging 0.88
Z1176:Abca13 UTSW 11 9,285,182 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,285,181 (GRCm39) missense probably damaging 1.00
Z1176:Abca13 UTSW 11 9,244,342 (GRCm39) missense probably benign 0.01
Z1177:Abca13 UTSW 11 9,264,545 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCAATCTCTCAAGAAGGCAG -3'
(R):5'- TGCATCCAGAAGAGTCTTAACG -3'

Sequencing Primer
(F):5'- GACATAGAGCTTTTAGTAGGTCAGC -3'
(R):5'- GACATCAGCAAAGTCTTCCTTGGTG -3'
Posted On 2022-10-06