Incidental Mutation 'R9657:Serac1'
ID 727416
Institutional Source Beutler Lab
Gene Symbol Serac1
Ensembl Gene ENSMUSG00000015659
Gene Name serine active site containing 1
Synonyms 4930511N22Rik, D17Ertd141e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9657 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 6042196-6079741 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 6069383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 91 (V91I)
Ref Sequence ENSEMBL: ENSMUSP00000095043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024570] [ENSMUST00000097432]
AlphaFold Q3U213
Predicted Effect probably benign
Transcript: ENSMUST00000024570
SMART Domains Protein: ENSMUSP00000024570
Gene: ENSMUSG00000015659

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
SCOP:d1jdha_ 243 336 3e-5 SMART
Pfam:PGAP1 360 519 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097432
AA Change: V91I

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000095043
Gene: ENSMUSG00000015659
AA Change: V91I

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
SCOP:d1gw5a_ 89 464 3e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phosphatidylglycerol remodeling protein found at the interface of mitochondria and endoplasmic reticula, where it mediates phospholipid exchange. The encoded protein plays a major role in mitochondrial function and intracellular cholesterol trafficking. Defects in this gene are a cause of 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like syndrome (MEGDEL). Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,293,379 D1747E probably benign Het
Acad11 T A 9: 104,075,836 I88N possibly damaging Het
Atp2b4 T C 1: 133,728,740 E724G probably damaging Het
Bcl2a1b T C 9: 89,199,546 S63P probably damaging Het
Blzf1 T C 1: 164,306,454 S9G probably benign Het
Ccdc121 T C 1: 181,510,539 T283A probably benign Het
Ccdc130 T C 8: 84,260,455 K138E possibly damaging Het
Cdh22 T C 2: 165,123,795 D488G probably benign Het
Cep290 A G 10: 100,515,141 E688G possibly damaging Het
Cldn10 A C 14: 118,788,369 E71D probably benign Het
Clip2 C T 5: 134,504,762 R487Q probably benign Het
Cyp3a16 T C 5: 145,450,169 D337G probably null Het
D430042O09Rik A G 7: 125,842,784 S648G probably benign Het
Dnah5 A T 15: 28,409,943 D3654V probably damaging Het
Dock1 T C 7: 134,737,700 S100P possibly damaging Het
Gm35339 A G 15: 76,361,276 Y1271C Het
Hdgfl2 T C 17: 56,098,978 V488A unknown Het
Itih2 T C 2: 10,102,875 T627A probably damaging Het
Klhl33 T C 14: 50,896,660 D144G probably benign Het
Lca5l G A 16: 96,173,753 Q324* probably null Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mical2 A G 7: 112,322,599 T542A probably benign Het
Moxd1 T A 10: 24,252,587 V179E probably benign Het
Myh7b A G 2: 155,614,043 Y116C probably damaging Het
Myoc C T 1: 162,639,660 R133* probably null Het
Nol3 A T 8: 105,279,009 I12F probably damaging Het
Nrap A G 19: 56,363,945 V605A probably benign Het
Olfr1136 T C 2: 87,693,777 Y35C probably damaging Het
Olfr1158 A C 2: 87,990,966 N285T probably damaging Het
Pag1 G T 3: 9,704,731 S52R probably damaging Het
Pbxip1 A G 3: 89,447,749 D525G probably benign Het
Pla2g4f A G 2: 120,304,657 F437L probably benign Het
Podn A C 4: 108,027,034 I86S probably damaging Het
Postn A G 3: 54,383,399 T676A probably benign Het
Ppp1r1c A G 2: 79,808,374 E104G probably benign Het
Prss53 T C 7: 127,887,066 T436A probably damaging Het
Psme4 A T 11: 30,838,980 E1127D probably benign Het
Ptpn18 C A 1: 34,473,392 A426E possibly damaging Het
Ptprz1 T G 6: 23,042,378 C2044G possibly damaging Het
Rad54l2 C A 9: 106,704,173 V850L probably damaging Het
Ranbp9 A G 13: 43,403,679 I28T unknown Het
Rapgef2 A T 3: 79,091,884 V527E probably damaging Het
Rere C A 4: 150,614,933 P825T unknown Het
Rundc3a A G 11: 102,400,752 T349A probably benign Het
Scn2a T C 2: 65,735,688 F1352S probably damaging Het
Senp7 T A 16: 56,123,932 C206* probably null Het
Serpina1f G A 12: 103,689,791 Q393* probably null Het
Slc8a1 T C 17: 81,647,815 E598G probably damaging Het
Slmap A T 14: 26,429,858 H518Q probably benign Het
Spg11 G A 2: 122,080,300 R1199C probably damaging Het
Tada1 T C 1: 166,386,743 S104P possibly damaging Het
Tbck A G 3: 132,715,690 D186G probably damaging Het
Tdrd9 A C 12: 112,036,390 R824S possibly damaging Het
Tmem161a T C 8: 70,177,610 probably null Het
Trim55 G A 3: 19,674,507 G494D possibly damaging Het
Ttc17 T A 2: 94,406,665 M1L probably benign Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Ugt3a1 A C 15: 9,280,047 S32R probably damaging Het
Vgll3 T C 16: 65,839,457 S220P probably benign Het
Virma A G 4: 11,544,898 E1569G probably damaging Het
Vmn1r54 C G 6: 90,270,002 F299L probably benign Het
Vmn2r114 A G 17: 23,291,716 S597P probably damaging Het
Wdr7 A G 18: 63,924,847 D1249G probably damaging Het
Ypel4 A G 2: 84,737,724 Y108C probably damaging Het
Zfp770 A G 2: 114,197,285 V101A probably damaging Het
Zfyve9 A T 4: 108,718,532 C451S probably damaging Het
Other mutations in Serac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Serac1 APN 17 6074253 splice site probably benign
IGL02642:Serac1 APN 17 6045746 missense possibly damaging 0.56
IGL02972:Serac1 APN 17 6070764 nonsense probably null
FR4304:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4340:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4342:Serac1 UTSW 17 6070808 missense probably damaging 1.00
FR4589:Serac1 UTSW 17 6070808 missense probably damaging 1.00
PIT4480001:Serac1 UTSW 17 6050812 missense probably damaging 1.00
R0076:Serac1 UTSW 17 6064937 splice site probably benign
R0076:Serac1 UTSW 17 6064937 splice site probably benign
R0127:Serac1 UTSW 17 6048840 missense probably damaging 1.00
R0211:Serac1 UTSW 17 6050060 missense possibly damaging 0.67
R0245:Serac1 UTSW 17 6051756 missense probably damaging 1.00
R0538:Serac1 UTSW 17 6048826 splice site probably benign
R0652:Serac1 UTSW 17 6051756 missense probably damaging 1.00
R0988:Serac1 UTSW 17 6061580 missense probably benign 0.02
R1965:Serac1 UTSW 17 6048999 missense possibly damaging 0.72
R1984:Serac1 UTSW 17 6045689 splice site probably null
R2145:Serac1 UTSW 17 6050785 missense probably damaging 1.00
R3426:Serac1 UTSW 17 6066778 missense probably benign 0.04
R3921:Serac1 UTSW 17 6066792 missense probably damaging 1.00
R4760:Serac1 UTSW 17 6051790 missense possibly damaging 0.69
R4958:Serac1 UTSW 17 6069382 missense probably benign 0.15
R5552:Serac1 UTSW 17 6056692 nonsense probably null
R5874:Serac1 UTSW 17 6043913 unclassified probably benign
R5964:Serac1 UTSW 17 6065049 missense probably benign
R6614:Serac1 UTSW 17 6045662 missense probably damaging 1.00
R6794:Serac1 UTSW 17 6051710 missense probably damaging 1.00
R6949:Serac1 UTSW 17 6051815 missense probably damaging 1.00
R7157:Serac1 UTSW 17 6074201 missense probably benign
R7161:Serac1 UTSW 17 6065076 missense probably damaging 0.97
R7426:Serac1 UTSW 17 6069314 missense probably damaging 1.00
R8270:Serac1 UTSW 17 6050758 missense probably damaging 1.00
R8733:Serac1 UTSW 17 6050028 missense probably damaging 1.00
R8785:Serac1 UTSW 17 6044202 missense probably damaging 0.99
R9057:Serac1 UTSW 17 6061615 missense probably damaging 0.98
Z1088:Serac1 UTSW 17 6048918 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGTTCTTCTGCCAGCTTC -3'
(R):5'- CACAGTGGAAATGTGTTGCC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- GGAAATGTGTTGCCACTTACAGC -3'
Posted On 2022-10-06