Incidental Mutation 'R9657:Vmn2r114'
ID 727417
Institutional Source Beutler Lab
Gene Symbol Vmn2r114
Ensembl Gene ENSMUSG00000091945
Gene Name vomeronasal 2, receptor 114
Synonyms EG666002
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.131) question?
Stock # R9657 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23509908-23531287 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23510690 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 597 (S597P)
Ref Sequence ENSEMBL: ENSMUSP00000127505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168033]
AlphaFold E9Q281
Predicted Effect probably damaging
Transcript: ENSMUST00000168033
AA Change: S597P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127505
Gene: ENSMUSG00000091945
AA Change: S597P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 154 470 1.5e-24 PFAM
Pfam:NCD3G 511 564 1.5e-18 PFAM
Pfam:7tm_3 597 832 1.4e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,243,379 (GRCm39) D1747E probably benign Het
Acad11 T A 9: 103,953,035 (GRCm39) I88N possibly damaging Het
Atp2b4 T C 1: 133,656,478 (GRCm39) E724G probably damaging Het
Bcl2a1b T C 9: 89,081,599 (GRCm39) S63P probably damaging Het
Blzf1 T C 1: 164,134,023 (GRCm39) S9G probably benign Het
Ccdc121rt1 T C 1: 181,338,104 (GRCm39) T283A probably benign Het
Cdh22 T C 2: 164,965,715 (GRCm39) D488G probably benign Het
Cep290 A G 10: 100,351,003 (GRCm39) E688G possibly damaging Het
Cldn10 A C 14: 119,025,781 (GRCm39) E71D probably benign Het
Clip2 C T 5: 134,533,616 (GRCm39) R487Q probably benign Het
Cyp3a16 T C 5: 145,386,979 (GRCm39) D337G probably null Het
Dnah5 A T 15: 28,410,089 (GRCm39) D3654V probably damaging Het
Dock1 T C 7: 134,339,429 (GRCm39) S100P possibly damaging Het
Hdgfl2 T C 17: 56,405,978 (GRCm39) V488A unknown Het
Itih2 T C 2: 10,107,686 (GRCm39) T627A probably damaging Het
Katnip A G 7: 125,441,956 (GRCm39) S648G probably benign Het
Klhl33 T C 14: 51,134,117 (GRCm39) D144G probably benign Het
Lca5l G A 16: 95,974,953 (GRCm39) Q324* probably null Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mical2 A G 7: 111,921,806 (GRCm39) T542A probably benign Het
Moxd1 T A 10: 24,128,485 (GRCm39) V179E probably benign Het
Myh7b A G 2: 155,455,963 (GRCm39) Y116C probably damaging Het
Myoc C T 1: 162,467,229 (GRCm39) R133* probably null Het
Nol3 A T 8: 106,005,641 (GRCm39) I12F probably damaging Het
Nrap A G 19: 56,352,377 (GRCm39) V605A probably benign Het
Or5w13 T C 2: 87,524,121 (GRCm39) Y35C probably damaging Het
Or9m2 A C 2: 87,821,310 (GRCm39) N285T probably damaging Het
Pag1 G T 3: 9,769,791 (GRCm39) S52R probably damaging Het
Pbxip1 A G 3: 89,355,056 (GRCm39) D525G probably benign Het
Pla2g4f A G 2: 120,135,138 (GRCm39) F437L probably benign Het
Podn A C 4: 107,884,231 (GRCm39) I86S probably damaging Het
Postn A G 3: 54,290,820 (GRCm39) T676A probably benign Het
Ppp1r1c A G 2: 79,638,718 (GRCm39) E104G probably benign Het
Prss53 T C 7: 127,486,238 (GRCm39) T436A probably damaging Het
Psme4 A T 11: 30,788,980 (GRCm39) E1127D probably benign Het
Ptpn18 C A 1: 34,512,473 (GRCm39) A426E possibly damaging Het
Ptprz1 T G 6: 23,042,377 (GRCm39) C2044G possibly damaging Het
Rad54l2 C A 9: 106,581,372 (GRCm39) V850L probably damaging Het
Ranbp9 A G 13: 43,557,155 (GRCm39) I28T unknown Het
Rapgef2 A T 3: 78,999,191 (GRCm39) V527E probably damaging Het
Rere C A 4: 150,699,390 (GRCm39) P825T unknown Het
Rundc3a A G 11: 102,291,578 (GRCm39) T349A probably benign Het
Scn2a T C 2: 65,566,032 (GRCm39) F1352S probably damaging Het
Senp7 T A 16: 55,944,295 (GRCm39) C206* probably null Het
Serac1 C T 17: 6,119,658 (GRCm39) V91I probably benign Het
Serpina1f G A 12: 103,656,050 (GRCm39) Q393* probably null Het
Slc8a1 T C 17: 81,955,244 (GRCm39) E598G probably damaging Het
Slmap A T 14: 26,151,013 (GRCm39) H518Q probably benign Het
Spg11 G A 2: 121,910,781 (GRCm39) R1199C probably damaging Het
Tada1 T C 1: 166,214,312 (GRCm39) S104P possibly damaging Het
Tbck A G 3: 132,421,451 (GRCm39) D186G probably damaging Het
Tdrd9 A C 12: 112,002,824 (GRCm39) R824S possibly damaging Het
Tmem161a T C 8: 70,630,260 (GRCm39) probably null Het
Trim55 G A 3: 19,728,671 (GRCm39) G494D possibly damaging Het
Ttc17 T A 2: 94,237,010 (GRCm39) M1L probably benign Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Ugt3a1 A C 15: 9,280,133 (GRCm39) S32R probably damaging Het
Vgll3 T C 16: 65,636,343 (GRCm39) S220P probably benign Het
Virma A G 4: 11,544,898 (GRCm39) E1569G probably damaging Het
Vmn1r54 C G 6: 90,246,984 (GRCm39) F299L probably benign Het
Wdr7 A G 18: 64,057,918 (GRCm39) D1249G probably damaging Het
Wdr97 A G 15: 76,245,476 (GRCm39) Y1271C Het
Yju2b T C 8: 84,987,084 (GRCm39) K138E possibly damaging Het
Ypel4 A G 2: 84,568,068 (GRCm39) Y108C probably damaging Het
Zfp770 A G 2: 114,027,766 (GRCm39) V101A probably damaging Het
Zfyve9 A T 4: 108,575,729 (GRCm39) C451S probably damaging Het
Other mutations in Vmn2r114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Vmn2r114 APN 17 23,510,639 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r114 APN 17 23,510,212 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r114 APN 17 23,509,957 (GRCm39) missense probably benign 0.23
IGL00990:Vmn2r114 APN 17 23,509,939 (GRCm39) missense probably benign
IGL01838:Vmn2r114 APN 17 23,515,956 (GRCm39) missense probably benign 0.44
IGL01990:Vmn2r114 APN 17 23,529,355 (GRCm39) missense probably benign 0.22
IGL01994:Vmn2r114 APN 17 23,529,451 (GRCm39) missense probably damaging 1.00
IGL02153:Vmn2r114 APN 17 23,510,782 (GRCm39) missense probably benign 0.01
IGL02453:Vmn2r114 APN 17 23,530,108 (GRCm39) missense probably benign 0.00
IGL02621:Vmn2r114 APN 17 23,529,494 (GRCm39) missense probably damaging 0.98
IGL02938:Vmn2r114 APN 17 23,510,263 (GRCm39) missense probably benign 0.10
IGL03130:Vmn2r114 APN 17 23,515,970 (GRCm39) splice site probably benign
IGL03325:Vmn2r114 APN 17 23,510,652 (GRCm39) missense probably damaging 1.00
BB004:Vmn2r114 UTSW 17 23,510,619 (GRCm39) missense probably damaging 1.00
R0109:Vmn2r114 UTSW 17 23,529,549 (GRCm39) nonsense probably null
R0164:Vmn2r114 UTSW 17 23,528,800 (GRCm39) critical splice donor site probably null
R0310:Vmn2r114 UTSW 17 23,509,917 (GRCm39) missense probably benign 0.23
R0583:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R0677:Vmn2r114 UTSW 17 23,529,568 (GRCm39) missense probably damaging 1.00
R1127:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R1147:Vmn2r114 UTSW 17 23,530,037 (GRCm39) missense probably benign 0.00
R1147:Vmn2r114 UTSW 17 23,530,037 (GRCm39) missense probably benign 0.00
R1157:Vmn2r114 UTSW 17 23,529,314 (GRCm39) missense possibly damaging 0.60
R1323:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R1347:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R1435:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R1437:Vmn2r114 UTSW 17 23,510,185 (GRCm39) missense probably damaging 1.00
R1585:Vmn2r114 UTSW 17 23,510,675 (GRCm39) missense probably damaging 0.98
R1641:Vmn2r114 UTSW 17 23,515,962 (GRCm39) missense probably benign 0.00
R1748:Vmn2r114 UTSW 17 23,527,035 (GRCm39) missense probably benign 0.17
R1954:Vmn2r114 UTSW 17 23,530,086 (GRCm39) missense probably benign 0.32
R2081:Vmn2r114 UTSW 17 23,510,083 (GRCm39) missense possibly damaging 0.91
R2103:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R2113:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R2134:Vmn2r114 UTSW 17 23,510,737 (GRCm39) missense probably damaging 1.00
R2149:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R2424:Vmn2r114 UTSW 17 23,515,842 (GRCm39) missense possibly damaging 0.90
R2847:Vmn2r114 UTSW 17 23,509,948 (GRCm39) missense probably benign 0.00
R2848:Vmn2r114 UTSW 17 23,509,948 (GRCm39) missense probably benign 0.00
R2893:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3017:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3018:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3019:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3020:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R3021:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R4628:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R4668:Vmn2r114 UTSW 17 23,529,447 (GRCm39) missense possibly damaging 0.83
R4840:Vmn2r114 UTSW 17 23,510,353 (GRCm39) missense probably damaging 0.97
R4841:Vmn2r114 UTSW 17 23,529,336 (GRCm39) missense probably benign 0.04
R4842:Vmn2r114 UTSW 17 23,529,336 (GRCm39) missense probably benign 0.04
R4856:Vmn2r114 UTSW 17 23,527,008 (GRCm39) missense probably benign 0.11
R4886:Vmn2r114 UTSW 17 23,527,008 (GRCm39) missense probably benign 0.11
R4992:Vmn2r114 UTSW 17 23,510,765 (GRCm39) missense probably benign 0.03
R5182:Vmn2r114 UTSW 17 23,510,632 (GRCm39) missense probably damaging 0.96
R5223:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R5405:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R5449:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R5615:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
R5834:Vmn2r114 UTSW 17 23,529,599 (GRCm39) missense possibly damaging 0.90
R6150:Vmn2r114 UTSW 17 23,510,269 (GRCm39) missense probably benign 0.03
R6277:Vmn2r114 UTSW 17 23,509,954 (GRCm39) missense possibly damaging 0.93
R6403:Vmn2r114 UTSW 17 23,528,939 (GRCm39) missense probably damaging 0.99
R6589:Vmn2r114 UTSW 17 23,510,642 (GRCm39) missense probably damaging 1.00
R6613:Vmn2r114 UTSW 17 23,529,220 (GRCm39) missense possibly damaging 0.82
R6747:Vmn2r114 UTSW 17 23,528,850 (GRCm39) missense probably benign 0.00
R6837:Vmn2r114 UTSW 17 23,529,176 (GRCm39) missense probably benign 0.10
R6911:Vmn2r114 UTSW 17 23,510,104 (GRCm39) missense probably damaging 0.98
R6950:Vmn2r114 UTSW 17 23,529,137 (GRCm39) missense probably benign 0.03
R7276:Vmn2r114 UTSW 17 23,509,934 (GRCm39) missense probably damaging 0.97
R7482:Vmn2r114 UTSW 17 23,510,468 (GRCm39) missense probably damaging 1.00
R7514:Vmn2r114 UTSW 17 23,527,035 (GRCm39) missense probably null 0.96
R7523:Vmn2r114 UTSW 17 23,529,611 (GRCm39) missense probably benign 0.01
R7563:Vmn2r114 UTSW 17 23,510,000 (GRCm39) missense probably benign 0.01
R7585:Vmn2r114 UTSW 17 23,510,239 (GRCm39) missense probably damaging 1.00
R7593:Vmn2r114 UTSW 17 23,510,817 (GRCm39) nonsense probably null
R7611:Vmn2r114 UTSW 17 23,515,944 (GRCm39) missense probably damaging 0.97
R7641:Vmn2r114 UTSW 17 23,527,177 (GRCm39) missense possibly damaging 0.53
R7651:Vmn2r114 UTSW 17 23,509,986 (GRCm39) nonsense probably null
R7970:Vmn2r114 UTSW 17 23,530,186 (GRCm39) missense probably benign 0.00
R8737:Vmn2r114 UTSW 17 23,529,142 (GRCm39) missense probably benign 0.36
R8802:Vmn2r114 UTSW 17 23,528,836 (GRCm39) missense possibly damaging 0.65
R8847:Vmn2r114 UTSW 17 23,528,986 (GRCm39) missense probably damaging 1.00
R8991:Vmn2r114 UTSW 17 23,529,286 (GRCm39) missense probably damaging 1.00
R9138:Vmn2r114 UTSW 17 23,510,578 (GRCm39) missense probably damaging 1.00
R9173:Vmn2r114 UTSW 17 23,510,527 (GRCm39) missense probably damaging 0.99
R9175:Vmn2r114 UTSW 17 23,527,212 (GRCm39) missense probably damaging 1.00
R9670:Vmn2r114 UTSW 17 23,531,098 (GRCm39) missense
X0065:Vmn2r114 UTSW 17 23,529,931 (GRCm39) missense probably benign 0.34
Z1088:Vmn2r114 UTSW 17 23,509,906 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- GTTTTAGCCAAGACAGTGGAAACAG -3'
(R):5'- TCCTGTCAGTAAAATTGCTAAAGC -3'

Sequencing Primer
(F):5'- CAACTCCAAATGTGATTTGCTGTAGG -3'
(R):5'- TGTCAGTAAAATTGCTAAAGCTACAC -3'
Posted On 2022-10-06