Incidental Mutation 'R9659:Ly75'
ID 727428
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Name lymphocyte antigen 75
Synonyms DEC-205, CD205
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9659 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 60122447-60213617 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 60168665 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 748 (D748Y)
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
AlphaFold Q60767
Predicted Effect probably damaging
Transcript: ENSMUST00000028362
AA Change: D748Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: D748Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112533
AA Change: D748Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: D748Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330070K13Rik T C 5: 130,407,876 (GRCm39) I112V unknown Het
Adcy7 A G 8: 89,045,733 (GRCm39) T572A probably benign Het
Atad5 G T 11: 79,980,542 (GRCm39) probably benign Het
C2cd2 A G 16: 97,723,473 (GRCm39) S15P possibly damaging Het
Cabp1 T C 5: 115,311,187 (GRCm39) D289G possibly damaging Het
Ccdc14 A G 16: 34,541,913 (GRCm39) I545V probably damaging Het
Cep295 C A 9: 15,233,846 (GRCm39) A2317S probably benign Het
Cerkl T C 2: 79,223,322 (GRCm39) D133G possibly damaging Het
Cited4 T G 4: 120,524,543 (GRCm39) C182G probably damaging Het
Col6a5 T A 9: 105,811,034 (GRCm39) K828N unknown Het
Ear2 A G 14: 44,340,705 (GRCm39) Y121C probably damaging Het
Ect2l C T 10: 18,041,347 (GRCm39) C369Y possibly damaging Het
Elapor1 G A 3: 108,377,297 (GRCm39) T387I possibly damaging Het
Ep300 A G 15: 81,505,273 (GRCm39) Y631C unknown Het
Ephb4 T G 5: 137,363,743 (GRCm39) Y583D probably damaging Het
Fbn2 C G 18: 58,342,654 (GRCm39) R75P probably damaging Het
Gabra2 T C 5: 71,192,140 (GRCm39) D63G probably benign Het
Gfra1 A G 19: 58,441,652 (GRCm39) M93T probably damaging Het
Gm21886 AGAGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGCAGACAGCAGGTGCTCACTGAGGCCTG AGAGGCCTG 18: 80,132,776 (GRCm39) probably benign Het
Gm3604 A T 13: 62,519,724 (GRCm39) H10Q possibly damaging Het
Helz2 T C 2: 180,882,025 (GRCm39) D256G probably benign Het
Herc1 A C 9: 66,307,185 (GRCm39) I1002L probably benign Het
Hpgd C G 8: 56,772,075 (GRCm39) C182W probably damaging Het
Htr5b A G 1: 121,455,428 (GRCm39) L164P possibly damaging Het
Kmo T C 1: 175,486,085 (GRCm39) F403L probably damaging Het
Mcm5 C T 8: 75,844,168 (GRCm39) S313F probably benign Het
Mipep A G 14: 61,083,893 (GRCm39) T595A probably damaging Het
Muc6 T C 7: 141,232,100 (GRCm39) D968G probably damaging Het
Myo18b T C 5: 113,022,382 (GRCm39) T337A unknown Het
Nlrp1b T A 11: 71,073,132 (GRCm39) Q237L possibly damaging Het
Nr1h4 A G 10: 89,314,638 (GRCm39) probably null Het
Nxph1 A G 6: 9,247,418 (GRCm39) T130A probably damaging Het
Or10al6 T G 17: 38,082,880 (GRCm39) F112C probably damaging Het
Or1l4 T A 2: 37,091,897 (GRCm39) C215S possibly damaging Het
Or4m1 A G 14: 50,558,181 (GRCm39) F37S probably benign Het
Or5p4 T C 7: 107,680,745 (GRCm39) V248A probably damaging Het
Or8g21 A G 9: 38,906,296 (GRCm39) V145A possibly damaging Het
Pcsk5 A G 19: 17,455,245 (GRCm39) Y1062H probably benign Het
Plch1 T C 3: 63,681,136 (GRCm39) I164V probably benign Het
Plekhh2 T A 17: 84,854,892 (GRCm39) M42K possibly damaging Het
Polr2a T C 11: 69,625,654 (GRCm39) Y1832C unknown Het
Prpf4 G A 4: 62,334,296 (GRCm39) probably null Het
Psg16 T C 7: 16,824,524 (GRCm39) S12P possibly damaging Het
Ptpn14 T A 1: 189,587,174 (GRCm39) M528K probably benign Het
Rb1cc1 T A 1: 6,318,673 (GRCm39) H697Q probably benign Het
Reg3a T G 6: 78,360,574 (GRCm39) C171G possibly damaging Het
Slc22a26 G A 19: 7,763,798 (GRCm39) P412S probably benign Het
Spata31e5 G T 1: 28,816,536 (GRCm39) H499N probably benign Het
Tcstv2a T A 13: 120,725,754 (GRCm39) D139E probably damaging Het
Tlk2 T C 11: 105,131,263 (GRCm39) I203T probably benign Het
Tmem120b T G 5: 123,253,788 (GRCm39) H279Q probably damaging Het
Trip4 T C 9: 65,740,702 (GRCm39) E535G probably benign Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Ubr5 A T 15: 37,984,254 (GRCm39) L2298I Het
Utp20 A G 10: 88,653,171 (GRCm39) L303P probably damaging Het
Vcan A G 13: 89,839,860 (GRCm39) Y1895H probably damaging Het
Vmn2r2 T C 3: 64,041,942 (GRCm39) N258D possibly damaging Het
Wdr20rt A T 12: 65,273,343 (GRCm39) S269C probably damaging Het
Zfand4 T G 6: 116,282,588 (GRCm39) Y54D probably damaging Het
Zfp82 C T 7: 29,755,963 (GRCm39) R373H probably damaging Het
Zmiz2 A G 11: 6,346,814 (GRCm39) E141G probably benign Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60,206,421 (GRCm39) missense probably damaging 1.00
IGL01072:Ly75 APN 2 60,184,840 (GRCm39) missense probably damaging 1.00
IGL01409:Ly75 APN 2 60,152,036 (GRCm39) splice site probably null
IGL01432:Ly75 APN 2 60,206,351 (GRCm39) missense probably damaging 1.00
IGL01626:Ly75 APN 2 60,131,359 (GRCm39) missense probably benign 0.13
IGL01690:Ly75 APN 2 60,168,655 (GRCm39) missense probably damaging 1.00
IGL01862:Ly75 APN 2 60,129,516 (GRCm39) missense probably damaging 1.00
IGL01982:Ly75 APN 2 60,142,108 (GRCm39) missense probably damaging 1.00
IGL02075:Ly75 APN 2 60,182,700 (GRCm39) missense probably damaging 0.99
IGL02338:Ly75 APN 2 60,184,796 (GRCm39) missense probably benign 0.04
IGL02364:Ly75 APN 2 60,188,851 (GRCm39) missense probably damaging 1.00
IGL02456:Ly75 APN 2 60,124,125 (GRCm39) missense probably benign 0.09
IGL02474:Ly75 APN 2 60,213,526 (GRCm39) missense probably null 1.00
IGL02608:Ly75 APN 2 60,152,244 (GRCm39) missense probably benign 0.41
IGL02986:Ly75 APN 2 60,138,535 (GRCm39) missense probably damaging 1.00
IGL03015:Ly75 APN 2 60,206,504 (GRCm39) missense probably damaging 1.00
IGL03049:Ly75 APN 2 60,182,414 (GRCm39) missense probably damaging 0.99
euphues UTSW 2 60,129,389 (GRCm39) critical splice donor site probably null
four_score UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
lyly UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
Witty UTSW 2 60,184,844 (GRCm39) missense probably damaging 1.00
D605:Ly75 UTSW 2 60,182,696 (GRCm39) critical splice donor site probably null
R0046:Ly75 UTSW 2 60,169,801 (GRCm39) intron probably benign
R0055:Ly75 UTSW 2 60,152,262 (GRCm39) missense probably benign 0.01
R0055:Ly75 UTSW 2 60,152,262 (GRCm39) missense probably benign 0.01
R0071:Ly75 UTSW 2 60,152,163 (GRCm39) missense probably benign 0.01
R0071:Ly75 UTSW 2 60,152,163 (GRCm39) missense probably benign 0.01
R0285:Ly75 UTSW 2 60,148,663 (GRCm39) missense probably damaging 1.00
R0387:Ly75 UTSW 2 60,136,748 (GRCm39) missense probably benign 0.20
R0492:Ly75 UTSW 2 60,138,620 (GRCm39) missense probably damaging 1.00
R0688:Ly75 UTSW 2 60,146,565 (GRCm39) missense probably benign 0.41
R1367:Ly75 UTSW 2 60,124,102 (GRCm39) splice site probably null
R1463:Ly75 UTSW 2 60,199,101 (GRCm39) critical splice donor site probably null
R1581:Ly75 UTSW 2 60,158,237 (GRCm39) missense probably damaging 1.00
R1663:Ly75 UTSW 2 60,144,578 (GRCm39) missense probably damaging 1.00
R1818:Ly75 UTSW 2 60,142,121 (GRCm39) missense probably damaging 1.00
R1881:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R2244:Ly75 UTSW 2 60,180,257 (GRCm39) missense probably benign 0.01
R2905:Ly75 UTSW 2 60,164,898 (GRCm39) missense probably benign 0.00
R3967:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60,183,339 (GRCm39) missense probably damaging 1.00
R4406:Ly75 UTSW 2 60,184,894 (GRCm39) missense probably damaging 1.00
R4526:Ly75 UTSW 2 60,161,117 (GRCm39) missense probably benign 0.09
R4647:Ly75 UTSW 2 60,138,622 (GRCm39) missense probably damaging 1.00
R4795:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R4796:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R4962:Ly75 UTSW 2 60,182,469 (GRCm39) missense probably damaging 1.00
R4979:Ly75 UTSW 2 60,206,238 (GRCm39) missense probably damaging 1.00
R5072:Ly75 UTSW 2 60,206,307 (GRCm39) missense probably damaging 1.00
R5288:Ly75 UTSW 2 60,133,985 (GRCm39) missense probably damaging 1.00
R5373:Ly75 UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60,164,831 (GRCm39) nonsense probably null
R5385:Ly75 UTSW 2 60,133,985 (GRCm39) missense probably damaging 1.00
R5395:Ly75 UTSW 2 60,195,455 (GRCm39) missense probably benign 0.41
R5531:Ly75 UTSW 2 60,195,489 (GRCm39) missense probably damaging 0.98
R5662:Ly75 UTSW 2 60,182,725 (GRCm39) missense probably damaging 1.00
R5667:Ly75 UTSW 2 60,138,655 (GRCm39) missense probably damaging 1.00
R5668:Ly75 UTSW 2 60,184,844 (GRCm39) missense probably damaging 1.00
R5671:Ly75 UTSW 2 60,138,655 (GRCm39) missense probably damaging 1.00
R5677:Ly75 UTSW 2 60,129,426 (GRCm39) missense probably benign 0.00
R5764:Ly75 UTSW 2 60,148,783 (GRCm39) missense probably benign
R5896:Ly75 UTSW 2 60,213,490 (GRCm39) missense probably benign
R6025:Ly75 UTSW 2 60,206,306 (GRCm39) missense probably damaging 1.00
R6113:Ly75 UTSW 2 60,199,217 (GRCm39) missense probably benign 0.04
R6448:Ly75 UTSW 2 60,129,389 (GRCm39) critical splice donor site probably null
R6601:Ly75 UTSW 2 60,148,720 (GRCm39) missense probably benign 0.11
R6745:Ly75 UTSW 2 60,138,523 (GRCm39) missense probably damaging 1.00
R6955:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60,136,749 (GRCm39) missense probably benign
R7100:Ly75 UTSW 2 60,136,778 (GRCm39) missense probably benign
R7110:Ly75 UTSW 2 60,206,528 (GRCm39) missense probably benign 0.31
R7203:Ly75 UTSW 2 60,154,196 (GRCm39) nonsense probably null
R7291:Ly75 UTSW 2 60,160,337 (GRCm39) missense probably damaging 0.98
R7308:Ly75 UTSW 2 60,164,859 (GRCm39) missense probably benign 0.04
R7447:Ly75 UTSW 2 60,164,818 (GRCm39) nonsense probably null
R7512:Ly75 UTSW 2 60,164,907 (GRCm39) missense probably damaging 1.00
R7595:Ly75 UTSW 2 60,124,171 (GRCm39) missense probably benign 0.01
R7976:Ly75 UTSW 2 60,195,432 (GRCm39) missense probably damaging 1.00
R8005:Ly75 UTSW 2 60,163,278 (GRCm39) missense probably damaging 1.00
R8171:Ly75 UTSW 2 60,144,572 (GRCm39) missense possibly damaging 0.51
R8392:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R8705:Ly75 UTSW 2 60,148,729 (GRCm39) missense probably damaging 0.98
R8714:Ly75 UTSW 2 60,164,829 (GRCm39) missense probably damaging 1.00
R8798:Ly75 UTSW 2 60,154,270 (GRCm39) missense probably benign 0.32
R8799:Ly75 UTSW 2 60,178,785 (GRCm39) missense probably damaging 1.00
R8834:Ly75 UTSW 2 60,161,433 (GRCm39) missense probably benign
R8990:Ly75 UTSW 2 60,188,903 (GRCm39) missense probably benign 0.10
R9015:Ly75 UTSW 2 60,146,442 (GRCm39) missense probably benign
R9547:Ly75 UTSW 2 60,161,069 (GRCm39) critical splice donor site probably null
R9628:Ly75 UTSW 2 60,158,285 (GRCm39) missense probably damaging 1.00
R9660:Ly75 UTSW 2 60,154,184 (GRCm39) missense probably damaging 1.00
R9747:Ly75 UTSW 2 60,136,672 (GRCm39) critical splice donor site probably null
X0025:Ly75 UTSW 2 60,184,819 (GRCm39) missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60,182,477 (GRCm39) missense possibly damaging 0.65
Z1177:Ly75 UTSW 2 60,180,348 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCTGAGCTTACGTGATGC -3'
(R):5'- GGCATCCAGATCGTTCACAAAG -3'

Sequencing Primer
(F):5'- AGCTTACGTGATGCCAGATTTG -3'
(R):5'- CCAGATCGTTCACAAAGTATGAAATG -3'
Posted On 2022-10-06