Incidental Mutation 'R9659:Ly75'
ID 727428
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Name lymphocyte antigen 75
Synonyms DEC-205, CD205
Accession Numbers

Genbank: NM_013825

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9659 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 60292103-60383303 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 60338321 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 748 (D748Y)
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
AlphaFold Q60767
Predicted Effect probably damaging
Transcript: ENSMUST00000028362
AA Change: D748Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: D748Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112533
AA Change: D748Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: D748Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik G A 3: 108,469,981 T387I possibly damaging Het
A330070K13Rik T C 5: 130,379,035 I112V unknown Het
Adcy7 A G 8: 88,319,105 T572A probably benign Het
AF067061 T A 13: 120,264,218 D139E probably damaging Het
Atad5 G T 11: 80,089,716 probably benign Het
C2cd2 A G 16: 97,922,273 S15P possibly damaging Het
Cabp1 T C 5: 115,173,128 D289G possibly damaging Het
Ccdc14 A G 16: 34,721,543 I545V probably damaging Het
Cep295 C A 9: 15,322,550 A2317S probably benign Het
Cerkl T C 2: 79,392,978 D133G possibly damaging Het
Cited4 T G 4: 120,667,346 C182G probably damaging Het
Col6a5 T A 9: 105,933,835 K828N unknown Het
Ear2 A G 14: 44,103,248 Y121C probably damaging Het
Ect2l C T 10: 18,165,599 C369Y possibly damaging Het
Ep300 A G 15: 81,621,072 Y631C unknown Het
Ephb4 T G 5: 137,365,481 Y583D probably damaging Het
Fbn2 C G 18: 58,209,582 R75P probably damaging Het
Gabra2 T C 5: 71,034,797 D63G probably benign Het
Gfra1 A G 19: 58,453,220 M93T probably damaging Het
Gm21886 AGAGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGCAGACAGCAGGTGCTCACTGAGGCCTG AGAGGCCTG 18: 80,089,561 probably benign Het
Gm3604 A T 13: 62,371,910 H10Q possibly damaging Het
Gm597 G T 1: 28,777,455 H499N probably benign Het
Helz2 T C 2: 181,240,232 D256G probably benign Het
Herc1 A C 9: 66,399,903 I1002L probably benign Het
Hpgd C G 8: 56,319,040 C182W probably damaging Het
Htr5b A G 1: 121,527,699 L164P possibly damaging Het
Kmo T C 1: 175,658,519 F403L probably damaging Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mipep A G 14: 60,846,444 T595A probably damaging Het
Muc6 T C 7: 141,645,833 D968G probably damaging Het
Myo18b T C 5: 112,874,516 T337A unknown Het
Nlrp1b T A 11: 71,182,306 Q237L possibly damaging Het
Nr1h4 A G 10: 89,478,776 probably null Het
Nxph1 A G 6: 9,247,418 T130A probably damaging Het
Olfr122 T G 17: 37,771,989 F112C probably damaging Het
Olfr365 T A 2: 37,201,885 C215S possibly damaging Het
Olfr481 T C 7: 108,081,538 V248A probably damaging Het
Olfr734 A G 14: 50,320,724 F37S probably benign Het
Olfr935 A G 9: 38,995,000 V145A possibly damaging Het
Pcsk5 A G 19: 17,477,881 Y1062H probably benign Het
Plch1 T C 3: 63,773,715 I164V probably benign Het
Plekhh2 T A 17: 84,547,464 M42K possibly damaging Het
Polr2a T C 11: 69,734,828 Y1832C unknown Het
Prpf4 G A 4: 62,416,059 probably null Het
Psg16 T C 7: 17,090,599 S12P possibly damaging Het
Ptpn14 T A 1: 189,854,977 M528K probably benign Het
Rb1cc1 T A 1: 6,248,449 H697Q probably benign Het
Reg3a T G 6: 78,383,591 C171G possibly damaging Het
Slc22a26 G A 19: 7,786,433 P412S probably benign Het
Tlk2 T C 11: 105,240,437 I203T probably benign Het
Tmem120b T G 5: 123,115,725 H279Q probably damaging Het
Trip4 T C 9: 65,833,420 E535G probably benign Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Ubr5 A T 15: 37,984,010 L2298I Het
Utp20 A G 10: 88,817,309 L303P probably damaging Het
Vcan A G 13: 89,691,741 Y1895H probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Wdr20rt A T 12: 65,226,569 S269C probably damaging Het
Zfand4 T G 6: 116,305,627 Y54D probably damaging Het
Zfp82 C T 7: 30,056,538 R373H probably damaging Het
Zmiz2 A G 11: 6,396,814 E141G probably benign Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60376077 missense probably damaging 1.00
IGL01072:Ly75 APN 2 60354496 missense probably damaging 1.00
IGL01409:Ly75 APN 2 60321692 splice site probably null
IGL01432:Ly75 APN 2 60376007 missense probably damaging 1.00
IGL01626:Ly75 APN 2 60301015 missense probably benign 0.13
IGL01690:Ly75 APN 2 60338311 missense probably damaging 1.00
IGL01862:Ly75 APN 2 60299172 missense probably damaging 1.00
IGL01982:Ly75 APN 2 60311764 missense probably damaging 1.00
IGL02075:Ly75 APN 2 60352356 missense probably damaging 0.99
IGL02338:Ly75 APN 2 60354452 missense probably benign 0.04
IGL02364:Ly75 APN 2 60358507 missense probably damaging 1.00
IGL02456:Ly75 APN 2 60293781 missense probably benign 0.09
IGL02474:Ly75 APN 2 60383182 missense probably null 1.00
IGL02608:Ly75 APN 2 60321900 missense probably benign 0.41
IGL02986:Ly75 APN 2 60308191 missense probably damaging 1.00
IGL03015:Ly75 APN 2 60376160 missense probably damaging 1.00
IGL03049:Ly75 APN 2 60352070 missense probably damaging 0.99
euphues UTSW 2 60299045 critical splice donor site probably null
four_score UTSW 2 60311771 missense possibly damaging 0.75
lyly UTSW 2 60327873 missense possibly damaging 0.49
Witty UTSW 2 60354500 missense probably damaging 1.00
D605:Ly75 UTSW 2 60352352 critical splice donor site probably null
R0046:Ly75 UTSW 2 60339457 intron probably benign
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0055:Ly75 UTSW 2 60321918 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0071:Ly75 UTSW 2 60321819 missense probably benign 0.01
R0285:Ly75 UTSW 2 60318319 missense probably damaging 1.00
R0387:Ly75 UTSW 2 60306404 missense probably benign 0.20
R0492:Ly75 UTSW 2 60308276 missense probably damaging 1.00
R0688:Ly75 UTSW 2 60316221 missense probably benign 0.41
R1367:Ly75 UTSW 2 60293758 splice site probably null
R1463:Ly75 UTSW 2 60368757 critical splice donor site probably null
R1581:Ly75 UTSW 2 60327893 missense probably damaging 1.00
R1663:Ly75 UTSW 2 60314234 missense probably damaging 1.00
R1818:Ly75 UTSW 2 60311777 missense probably damaging 1.00
R1881:Ly75 UTSW 2 60349940 missense probably benign 0.00
R2244:Ly75 UTSW 2 60349913 missense probably benign 0.01
R2905:Ly75 UTSW 2 60334554 missense probably benign 0.00
R3967:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60352995 missense probably damaging 1.00
R4406:Ly75 UTSW 2 60354550 missense probably damaging 1.00
R4526:Ly75 UTSW 2 60330773 missense probably benign 0.09
R4647:Ly75 UTSW 2 60308278 missense probably damaging 1.00
R4795:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4796:Ly75 UTSW 2 60349940 missense probably benign 0.00
R4962:Ly75 UTSW 2 60352125 missense probably damaging 1.00
R4979:Ly75 UTSW 2 60375894 missense probably damaging 1.00
R5072:Ly75 UTSW 2 60375963 missense probably damaging 1.00
R5288:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5373:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60311771 missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60334487 nonsense probably null
R5385:Ly75 UTSW 2 60303641 missense probably damaging 1.00
R5395:Ly75 UTSW 2 60365111 missense probably benign 0.41
R5531:Ly75 UTSW 2 60365145 missense probably damaging 0.98
R5662:Ly75 UTSW 2 60352381 missense probably damaging 1.00
R5667:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5668:Ly75 UTSW 2 60354500 missense probably damaging 1.00
R5671:Ly75 UTSW 2 60308311 missense probably damaging 1.00
R5677:Ly75 UTSW 2 60299082 missense probably benign 0.00
R5764:Ly75 UTSW 2 60318439 missense probably benign
R5896:Ly75 UTSW 2 60383146 missense probably benign
R6025:Ly75 UTSW 2 60375962 missense probably damaging 1.00
R6113:Ly75 UTSW 2 60368873 missense probably benign 0.04
R6448:Ly75 UTSW 2 60299045 critical splice donor site probably null
R6601:Ly75 UTSW 2 60318376 missense probably benign 0.11
R6745:Ly75 UTSW 2 60308179 missense probably damaging 1.00
R6955:Ly75 UTSW 2 60327873 missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60306405 missense probably benign
R7100:Ly75 UTSW 2 60306434 missense probably benign
R7110:Ly75 UTSW 2 60376184 missense probably benign 0.31
R7203:Ly75 UTSW 2 60323852 nonsense probably null
R7291:Ly75 UTSW 2 60329993 missense probably damaging 0.98
R7308:Ly75 UTSW 2 60334515 missense probably benign 0.04
R7447:Ly75 UTSW 2 60334474 nonsense probably null
R7512:Ly75 UTSW 2 60334563 missense probably damaging 1.00
R7595:Ly75 UTSW 2 60293827 missense probably benign 0.01
R7976:Ly75 UTSW 2 60365088 missense probably damaging 1.00
R8005:Ly75 UTSW 2 60332934 missense probably damaging 1.00
R8171:Ly75 UTSW 2 60314228 missense possibly damaging 0.51
R8392:Ly75 UTSW 2 60349940 missense probably benign 0.00
R8705:Ly75 UTSW 2 60318385 missense probably damaging 0.98
R8714:Ly75 UTSW 2 60334485 missense probably damaging 1.00
R8798:Ly75 UTSW 2 60323926 missense probably benign 0.32
R8799:Ly75 UTSW 2 60348441 missense probably damaging 1.00
R8834:Ly75 UTSW 2 60331089 missense probably benign
R8990:Ly75 UTSW 2 60358559 missense probably benign 0.10
R9015:Ly75 UTSW 2 60316098 missense probably benign
R9547:Ly75 UTSW 2 60330725 critical splice donor site probably null
R9628:Ly75 UTSW 2 60327941 missense probably damaging 1.00
R9660:Ly75 UTSW 2 60323840 missense probably damaging 1.00
R9747:Ly75 UTSW 2 60306328 critical splice donor site probably null
X0025:Ly75 UTSW 2 60354475 missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60350004 nonsense probably null
Z1177:Ly75 UTSW 2 60352133 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGCCTGAGCTTACGTGATGC -3'
(R):5'- GGCATCCAGATCGTTCACAAAG -3'

Sequencing Primer
(F):5'- AGCTTACGTGATGCCAGATTTG -3'
(R):5'- CCAGATCGTTCACAAAGTATGAAATG -3'
Posted On 2022-10-06