Incidental Mutation 'R9659:Ephb4'
ID 727442
Institutional Source Beutler Lab
Gene Symbol Ephb4
Ensembl Gene ENSMUSG00000029710
Gene Name Eph receptor B4
Synonyms MDK2, Htk, Myk1, Tyro11
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9659 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 137350109-137378669 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 137365481 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 583 (Y583D)
Ref Sequence ENSEMBL: ENSMUSP00000106684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]
AlphaFold P54761
Predicted Effect probably damaging
Transcript: ENSMUST00000061244
AA Change: Y574D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: Y574D

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111054
AA Change: Y574D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: Y574D

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 1.4e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 3.4e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
Pfam:SAM_1 882 917 2.6e-7 PFAM
low complexity region 919 934 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111055
AA Change: Y583D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: Y583D

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 4.2e-10 PFAM
FN3 324 413 1.75e-6 SMART
FN3 443 525 1.07e-10 SMART
Pfam:EphA2_TM 550 621 5e-24 PFAM
TyrKc 624 883 5.09e-130 SMART
SAM 913 980 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144296
AA Change: Y574D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: Y574D

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166239
AA Change: Y574D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: Y574D

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik G A 3: 108,469,981 T387I possibly damaging Het
A330070K13Rik T C 5: 130,379,035 I112V unknown Het
Adcy7 A G 8: 88,319,105 T572A probably benign Het
AF067061 T A 13: 120,264,218 D139E probably damaging Het
Atad5 G T 11: 80,089,716 probably benign Het
C2cd2 A G 16: 97,922,273 S15P possibly damaging Het
Cabp1 T C 5: 115,173,128 D289G possibly damaging Het
Ccdc14 A G 16: 34,721,543 I545V probably damaging Het
Cep295 C A 9: 15,322,550 A2317S probably benign Het
Cerkl T C 2: 79,392,978 D133G possibly damaging Het
Cited4 T G 4: 120,667,346 C182G probably damaging Het
Col6a5 T A 9: 105,933,835 K828N unknown Het
Ear2 A G 14: 44,103,248 Y121C probably damaging Het
Ect2l C T 10: 18,165,599 C369Y possibly damaging Het
Ep300 A G 15: 81,621,072 Y631C unknown Het
Fbn2 C G 18: 58,209,582 R75P probably damaging Het
Gabra2 T C 5: 71,034,797 D63G probably benign Het
Gfra1 A G 19: 58,453,220 M93T probably damaging Het
Gm21886 AGAGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGCAGACAGCAGGTGCTCACTGAGGCCTG AGAGGCCTG 18: 80,089,561 probably benign Het
Gm3604 A T 13: 62,371,910 H10Q possibly damaging Het
Gm597 G T 1: 28,777,455 H499N probably benign Het
Helz2 T C 2: 181,240,232 D256G probably benign Het
Herc1 A C 9: 66,399,903 I1002L probably benign Het
Hpgd C G 8: 56,319,040 C182W probably damaging Het
Htr5b A G 1: 121,527,699 L164P possibly damaging Het
Kmo T C 1: 175,658,519 F403L probably damaging Het
Ly75 C A 2: 60,338,321 D748Y probably damaging Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mipep A G 14: 60,846,444 T595A probably damaging Het
Muc6 T C 7: 141,645,833 D968G probably damaging Het
Myo18b T C 5: 112,874,516 T337A unknown Het
Nlrp1b T A 11: 71,182,306 Q237L possibly damaging Het
Nr1h4 A G 10: 89,478,776 probably null Het
Nxph1 A G 6: 9,247,418 T130A probably damaging Het
Olfr122 T G 17: 37,771,989 F112C probably damaging Het
Olfr365 T A 2: 37,201,885 C215S possibly damaging Het
Olfr481 T C 7: 108,081,538 V248A probably damaging Het
Olfr734 A G 14: 50,320,724 F37S probably benign Het
Olfr935 A G 9: 38,995,000 V145A possibly damaging Het
Pcsk5 A G 19: 17,477,881 Y1062H probably benign Het
Plch1 T C 3: 63,773,715 I164V probably benign Het
Plekhh2 T A 17: 84,547,464 M42K possibly damaging Het
Polr2a T C 11: 69,734,828 Y1832C unknown Het
Prpf4 G A 4: 62,416,059 probably null Het
Psg16 T C 7: 17,090,599 S12P possibly damaging Het
Ptpn14 T A 1: 189,854,977 M528K probably benign Het
Rb1cc1 T A 1: 6,248,449 H697Q probably benign Het
Reg3a T G 6: 78,383,591 C171G possibly damaging Het
Slc22a26 G A 19: 7,786,433 P412S probably benign Het
Tlk2 T C 11: 105,240,437 I203T probably benign Het
Tmem120b T G 5: 123,115,725 H279Q probably damaging Het
Trip4 T C 9: 65,833,420 E535G probably benign Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Ubr5 A T 15: 37,984,010 L2298I Het
Utp20 A G 10: 88,817,309 L303P probably damaging Het
Vcan A G 13: 89,691,741 Y1895H probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Wdr20rt A T 12: 65,226,569 S269C probably damaging Het
Zfand4 T G 6: 116,305,627 Y54D probably damaging Het
Zfp82 C T 7: 30,056,538 R373H probably damaging Het
Zmiz2 A G 11: 6,396,814 E141G probably benign Het
Other mutations in Ephb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Ephb4 APN 5 137365615 splice site probably benign
IGL00948:Ephb4 APN 5 137366659 missense probably damaging 1.00
IGL01653:Ephb4 APN 5 137365741 splice site probably benign
IGL01885:Ephb4 APN 5 137357797 missense probably damaging 1.00
IGL01906:Ephb4 APN 5 137361194 missense probably damaging 1.00
IGL02089:Ephb4 APN 5 137370762 missense probably damaging 0.98
IGL02216:Ephb4 APN 5 137372070 missense possibly damaging 0.92
IGL02233:Ephb4 APN 5 137354501 nonsense probably null
IGL03080:Ephb4 APN 5 137354083 splice site probably benign
IGL03111:Ephb4 APN 5 137372505 missense probably benign 0.07
R0599:Ephb4 UTSW 5 137369855 missense probably damaging 1.00
R0744:Ephb4 UTSW 5 137365667 missense probably damaging 1.00
R1331:Ephb4 UTSW 5 137366534 splice site probably benign
R1441:Ephb4 UTSW 5 137361247 missense probably damaging 1.00
R1732:Ephb4 UTSW 5 137372178 missense possibly damaging 0.93
R1745:Ephb4 UTSW 5 137360434 missense probably benign
R1831:Ephb4 UTSW 5 137354415 missense probably damaging 1.00
R1865:Ephb4 UTSW 5 137363310 missense possibly damaging 0.53
R2165:Ephb4 UTSW 5 137354426 missense probably benign 0.08
R2206:Ephb4 UTSW 5 137357719 missense probably damaging 1.00
R2473:Ephb4 UTSW 5 137365700 missense probably benign 0.15
R4779:Ephb4 UTSW 5 137365702 missense probably benign 0.04
R4801:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R4802:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R5307:Ephb4 UTSW 5 137363312 missense probably damaging 1.00
R5452:Ephb4 UTSW 5 137361142 missense probably damaging 1.00
R5458:Ephb4 UTSW 5 137369852 missense probably damaging 1.00
R5475:Ephb4 UTSW 5 137354439 missense probably benign 0.00
R5662:Ephb4 UTSW 5 137372195 missense probably damaging 0.98
R5879:Ephb4 UTSW 5 137360416 missense probably benign 0.00
R6336:Ephb4 UTSW 5 137372085 missense probably damaging 1.00
R6443:Ephb4 UTSW 5 137360449 missense probably damaging 1.00
R6632:Ephb4 UTSW 5 137366587 missense probably damaging 0.99
R6973:Ephb4 UTSW 5 137369804 missense probably damaging 1.00
R7008:Ephb4 UTSW 5 137361274 missense probably benign 0.00
R7145:Ephb4 UTSW 5 137372046 missense probably damaging 1.00
R7421:Ephb4 UTSW 5 137354425 missense possibly damaging 0.88
R7593:Ephb4 UTSW 5 137361298 missense probably benign
R7635:Ephb4 UTSW 5 137372103 missense probably damaging 1.00
R7751:Ephb4 UTSW 5 137365675 missense probably damaging 1.00
R7825:Ephb4 UTSW 5 137372437 missense probably damaging 1.00
R8539:Ephb4 UTSW 5 137357855 missense probably damaging 1.00
R8904:Ephb4 UTSW 5 137370805 missense probably damaging 1.00
R9228:Ephb4 UTSW 5 137354562 missense possibly damaging 0.79
R9327:Ephb4 UTSW 5 137363267 missense probably damaging 0.99
R9513:Ephb4 UTSW 5 137363302 missense possibly damaging 0.76
R9788:Ephb4 UTSW 5 137365481 missense probably damaging 1.00
X0026:Ephb4 UTSW 5 137373558 missense probably damaging 1.00
Z1177:Ephb4 UTSW 5 137361359 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAAAGACTGGCCACCTGCTC -3'
(R):5'- TGCCTCATTAGGGTCTTCGTAAG -3'

Sequencing Primer
(F):5'- TGGTATCAACCTGCCGAATG -3'
(R):5'- TAGGGTCTTCGTAAGTAAAAGGATC -3'
Posted On 2022-10-06