Incidental Mutation 'R9660:Ly75'
ID 727489
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Name lymphocyte antigen 75
Synonyms DEC-205, CD205
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9660 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 60292103-60383303 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60323840 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1088 (S1088P)
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
AlphaFold Q60767
Predicted Effect probably damaging
Transcript: ENSMUST00000028362
AA Change: S1088P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: S1088P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112533
AA Change: S1088P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: S1088P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,252,255 (GRCm38) M819V probably benign Het
Abca5 T A 11: 110,277,422 (GRCm38) T1461S possibly damaging Het
Actl6b C T 5: 137,564,504 (GRCm38) R161C probably damaging Het
Aoc3 C G 11: 101,331,088 (GRCm38) P50R possibly damaging Het
Atr G A 9: 95,914,997 (GRCm38) A1698T probably benign Het
Caml T A 13: 55,631,857 (GRCm38) S248T possibly damaging Het
Cdh11 C T 8: 102,658,247 (GRCm38) G399S possibly damaging Het
Chrna10 G T 7: 102,112,209 (GRCm38) L392I probably benign Het
Clip2 C T 5: 134,504,762 (GRCm38) R487Q probably benign Het
Copg1 A G 6: 87,902,243 (GRCm38) I424V probably damaging Het
Cwh43 A T 5: 73,408,286 (GRCm38) N65Y possibly damaging Het
Defb1 A G 8: 21,794,470 (GRCm38) Y35C probably damaging Het
Disp2 T C 2: 118,790,146 (GRCm38) V453A probably benign Het
Dpp9 A G 17: 56,187,458 (GRCm38) Y834H probably damaging Het
Emsy A G 7: 98,613,078 (GRCm38) I598T possibly damaging Het
Entpd2 C T 2: 25,398,141 (GRCm38) R126C probably damaging Het
Fbxl17 A T 17: 63,499,431 (GRCm38) M196K probably benign Het
Gcc1 T C 6: 28,420,545 (GRCm38) R258G probably damaging Het
Gga2 A T 7: 122,007,271 (GRCm38) M157K possibly damaging Het
Gna11 T C 10: 81,535,084 (GRCm38) N106S probably benign Het
Gtf3c1 A C 7: 125,663,027 (GRCm38) S1116A possibly damaging Het
Gucy2d C A 7: 98,449,857 (GRCm38) D294E probably damaging Het
Igkv12-46 G T 6: 69,764,983 (GRCm38) P4T possibly damaging Het
Iqcf5 A T 9: 106,515,969 (GRCm38) I142L probably damaging Het
Klhdc9 A G 1: 171,359,789 (GRCm38) S214P probably damaging Het
Kmt2e T C 5: 23,478,619 (GRCm38) Y292H probably damaging Het
Lgr6 A G 1: 134,987,507 (GRCm38) L778P probably damaging Het
Lrrk2 A G 15: 91,734,025 (GRCm38) N909S probably benign Het
Mei1 G A 15: 82,081,897 (GRCm38) G240D Het
Miox A T 15: 89,334,500 (GRCm38) probably benign Het
Myo1e A G 9: 70,316,642 (GRCm38) Y128C probably damaging Het
Necab2 T C 8: 119,462,664 (GRCm38) V191A possibly damaging Het
Nlrp9a T A 7: 26,557,490 (GRCm38) Y178N probably damaging Het
Nr4a3 A G 4: 48,051,353 (GRCm38) T36A probably benign Het
Nup210l C T 3: 90,199,866 (GRCm38) P1570L probably benign Het
Nup210l A G 3: 90,198,095 (GRCm38) T1517A probably benign Het
Olfr573-ps1 C T 7: 102,942,052 (GRCm38) C175Y probably damaging Het
Or4a27 T C 2: 88,728,798 (GRCm38) K267R probably damaging Het
Or4g17 T G 2: 111,379,894 (GRCm38) I298R probably damaging Het
Or4p23 T C 2: 88,746,528 (GRCm38) Y120C probably damaging Het
Pcnx2 A T 8: 125,760,853 (GRCm38) S1804T probably damaging Het
Pdcd11 T A 19: 47,093,752 (GRCm38) V35D possibly damaging Het
Pde10a C A 17: 8,951,538 (GRCm38) T347K probably damaging Het
Rcc1l A G 5: 134,154,138 (GRCm38) Y432H probably benign Het
Rgs22 A T 15: 36,040,710 (GRCm38) V1001E probably benign Het
Ripor3 T A 2: 167,989,726 (GRCm38) D385V probably damaging Het
Rrbp1 T C 2: 143,989,258 (GRCm38) K330E probably damaging Het
Ryr3 T G 2: 112,833,729 (GRCm38) D1759A probably benign Het
Scube3 A G 17: 28,152,440 (GRCm38) D43G probably benign Het
Sec24b A G 3: 129,996,773 (GRCm38) I701T probably damaging Het
Setd5 G T 6: 113,151,405 (GRCm38) V1440L probably benign Het
Sik3 A G 9: 46,194,844 (GRCm38) K337E possibly damaging Het
Slc14a1 C A 18: 78,109,592 (GRCm38) A367S probably damaging Het
Slc1a6 T A 10: 78,812,864 (GRCm38) M473K probably benign Het
Spag16 A G 1: 69,923,683 (GRCm38) R330G probably benign Het
Spag6 C A 2: 18,699,236 (GRCm38) Q32K probably benign Het
Sspo G A 6: 48,455,773 (GRCm38) G861D probably damaging Het
Togaram2 T A 17: 71,717,370 (GRCm38) S850T probably damaging Het
Trbv15 A T 6: 41,141,616 (GRCm38) E102V possibly damaging Het
Trim43b G T 9: 89,091,342 (GRCm38) H113N probably benign Het
Trpm2 T A 10: 77,930,555 (GRCm38) I877L probably benign Het
Ttn C T 2: 76,885,013 (GRCm38) E7912K unknown Het
Ttn T C 2: 76,768,808 (GRCm38) I19286V probably benign Het
Tubb6 A G 18: 67,401,601 (GRCm38) H190R probably benign Het
Vmn1r214 T C 13: 23,034,837 (GRCm38) V167A probably benign Het
Vwf C A 6: 125,591,707 (GRCm38) L398I possibly damaging Het
Zfp9 G T 6: 118,466,890 (GRCm38) A58E probably benign Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60,376,077 (GRCm38) missense probably damaging 1.00
IGL01072:Ly75 APN 2 60,354,496 (GRCm38) missense probably damaging 1.00
IGL01409:Ly75 APN 2 60,321,692 (GRCm38) splice site probably null
IGL01432:Ly75 APN 2 60,376,007 (GRCm38) missense probably damaging 1.00
IGL01626:Ly75 APN 2 60,301,015 (GRCm38) missense probably benign 0.13
IGL01690:Ly75 APN 2 60,338,311 (GRCm38) missense probably damaging 1.00
IGL01862:Ly75 APN 2 60,299,172 (GRCm38) missense probably damaging 1.00
IGL01982:Ly75 APN 2 60,311,764 (GRCm38) missense probably damaging 1.00
IGL02075:Ly75 APN 2 60,352,356 (GRCm38) missense probably damaging 0.99
IGL02338:Ly75 APN 2 60,354,452 (GRCm38) missense probably benign 0.04
IGL02364:Ly75 APN 2 60,358,507 (GRCm38) missense probably damaging 1.00
IGL02456:Ly75 APN 2 60,293,781 (GRCm38) missense probably benign 0.09
IGL02474:Ly75 APN 2 60,383,182 (GRCm38) missense probably null 1.00
IGL02608:Ly75 APN 2 60,321,900 (GRCm38) missense probably benign 0.41
IGL02986:Ly75 APN 2 60,308,191 (GRCm38) missense probably damaging 1.00
IGL03015:Ly75 APN 2 60,376,160 (GRCm38) missense probably damaging 1.00
IGL03049:Ly75 APN 2 60,352,070 (GRCm38) missense probably damaging 0.99
euphues UTSW 2 60,299,045 (GRCm38) critical splice donor site probably null
four_score UTSW 2 60,311,771 (GRCm38) missense possibly damaging 0.75
lyly UTSW 2 60,327,873 (GRCm38) missense possibly damaging 0.49
Witty UTSW 2 60,354,500 (GRCm38) missense probably damaging 1.00
D605:Ly75 UTSW 2 60,352,352 (GRCm38) critical splice donor site probably null
R0046:Ly75 UTSW 2 60,339,457 (GRCm38) intron probably benign
R0055:Ly75 UTSW 2 60,321,918 (GRCm38) missense probably benign 0.01
R0055:Ly75 UTSW 2 60,321,918 (GRCm38) missense probably benign 0.01
R0071:Ly75 UTSW 2 60,321,819 (GRCm38) missense probably benign 0.01
R0071:Ly75 UTSW 2 60,321,819 (GRCm38) missense probably benign 0.01
R0285:Ly75 UTSW 2 60,318,319 (GRCm38) missense probably damaging 1.00
R0387:Ly75 UTSW 2 60,306,404 (GRCm38) missense probably benign 0.20
R0492:Ly75 UTSW 2 60,308,276 (GRCm38) missense probably damaging 1.00
R0688:Ly75 UTSW 2 60,316,221 (GRCm38) missense probably benign 0.41
R1367:Ly75 UTSW 2 60,293,758 (GRCm38) splice site probably null
R1463:Ly75 UTSW 2 60,368,757 (GRCm38) critical splice donor site probably null
R1581:Ly75 UTSW 2 60,327,893 (GRCm38) missense probably damaging 1.00
R1663:Ly75 UTSW 2 60,314,234 (GRCm38) missense probably damaging 1.00
R1818:Ly75 UTSW 2 60,311,777 (GRCm38) missense probably damaging 1.00
R1881:Ly75 UTSW 2 60,349,940 (GRCm38) missense probably benign 0.00
R2244:Ly75 UTSW 2 60,349,913 (GRCm38) missense probably benign 0.01
R2905:Ly75 UTSW 2 60,334,554 (GRCm38) missense probably benign 0.00
R3967:Ly75 UTSW 2 60,327,873 (GRCm38) missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60,327,873 (GRCm38) missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60,352,995 (GRCm38) missense probably damaging 1.00
R4406:Ly75 UTSW 2 60,354,550 (GRCm38) missense probably damaging 1.00
R4526:Ly75 UTSW 2 60,330,773 (GRCm38) missense probably benign 0.09
R4647:Ly75 UTSW 2 60,308,278 (GRCm38) missense probably damaging 1.00
R4795:Ly75 UTSW 2 60,349,940 (GRCm38) missense probably benign 0.00
R4796:Ly75 UTSW 2 60,349,940 (GRCm38) missense probably benign 0.00
R4962:Ly75 UTSW 2 60,352,125 (GRCm38) missense probably damaging 1.00
R4979:Ly75 UTSW 2 60,375,894 (GRCm38) missense probably damaging 1.00
R5072:Ly75 UTSW 2 60,375,963 (GRCm38) missense probably damaging 1.00
R5288:Ly75 UTSW 2 60,303,641 (GRCm38) missense probably damaging 1.00
R5373:Ly75 UTSW 2 60,311,771 (GRCm38) missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60,311,771 (GRCm38) missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60,334,487 (GRCm38) nonsense probably null
R5385:Ly75 UTSW 2 60,303,641 (GRCm38) missense probably damaging 1.00
R5395:Ly75 UTSW 2 60,365,111 (GRCm38) missense probably benign 0.41
R5531:Ly75 UTSW 2 60,365,145 (GRCm38) missense probably damaging 0.98
R5662:Ly75 UTSW 2 60,352,381 (GRCm38) missense probably damaging 1.00
R5667:Ly75 UTSW 2 60,308,311 (GRCm38) missense probably damaging 1.00
R5668:Ly75 UTSW 2 60,354,500 (GRCm38) missense probably damaging 1.00
R5671:Ly75 UTSW 2 60,308,311 (GRCm38) missense probably damaging 1.00
R5677:Ly75 UTSW 2 60,299,082 (GRCm38) missense probably benign 0.00
R5764:Ly75 UTSW 2 60,318,439 (GRCm38) missense probably benign
R5896:Ly75 UTSW 2 60,383,146 (GRCm38) missense probably benign
R6025:Ly75 UTSW 2 60,375,962 (GRCm38) missense probably damaging 1.00
R6113:Ly75 UTSW 2 60,368,873 (GRCm38) missense probably benign 0.04
R6448:Ly75 UTSW 2 60,299,045 (GRCm38) critical splice donor site probably null
R6601:Ly75 UTSW 2 60,318,376 (GRCm38) missense probably benign 0.11
R6745:Ly75 UTSW 2 60,308,179 (GRCm38) missense probably damaging 1.00
R6955:Ly75 UTSW 2 60,327,873 (GRCm38) missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60,306,405 (GRCm38) missense probably benign
R7100:Ly75 UTSW 2 60,306,434 (GRCm38) missense probably benign
R7110:Ly75 UTSW 2 60,376,184 (GRCm38) missense probably benign 0.31
R7203:Ly75 UTSW 2 60,323,852 (GRCm38) nonsense probably null
R7291:Ly75 UTSW 2 60,329,993 (GRCm38) missense probably damaging 0.98
R7308:Ly75 UTSW 2 60,334,515 (GRCm38) missense probably benign 0.04
R7447:Ly75 UTSW 2 60,334,474 (GRCm38) nonsense probably null
R7512:Ly75 UTSW 2 60,334,563 (GRCm38) missense probably damaging 1.00
R7595:Ly75 UTSW 2 60,293,827 (GRCm38) missense probably benign 0.01
R7976:Ly75 UTSW 2 60,365,088 (GRCm38) missense probably damaging 1.00
R8005:Ly75 UTSW 2 60,332,934 (GRCm38) missense probably damaging 1.00
R8171:Ly75 UTSW 2 60,314,228 (GRCm38) missense possibly damaging 0.51
R8392:Ly75 UTSW 2 60,349,940 (GRCm38) missense probably benign 0.00
R8705:Ly75 UTSW 2 60,318,385 (GRCm38) missense probably damaging 0.98
R8714:Ly75 UTSW 2 60,334,485 (GRCm38) missense probably damaging 1.00
R8798:Ly75 UTSW 2 60,323,926 (GRCm38) missense probably benign 0.32
R8799:Ly75 UTSW 2 60,348,441 (GRCm38) missense probably damaging 1.00
R8834:Ly75 UTSW 2 60,331,089 (GRCm38) missense probably benign
R8990:Ly75 UTSW 2 60,358,559 (GRCm38) missense probably benign 0.10
R9015:Ly75 UTSW 2 60,316,098 (GRCm38) missense probably benign
R9547:Ly75 UTSW 2 60,330,725 (GRCm38) critical splice donor site probably null
R9628:Ly75 UTSW 2 60,327,941 (GRCm38) missense probably damaging 1.00
R9659:Ly75 UTSW 2 60,338,321 (GRCm38) missense probably damaging 1.00
R9747:Ly75 UTSW 2 60,306,328 (GRCm38) critical splice donor site probably null
X0025:Ly75 UTSW 2 60,354,475 (GRCm38) missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60,352,133 (GRCm38) missense possibly damaging 0.65
Z1177:Ly75 UTSW 2 60,350,004 (GRCm38) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTTAGGATGTGTGCTGGC -3'
(R):5'- TCTTTCAAGGACCTTCAGAGTG -3'

Sequencing Primer
(F):5'- TGGCCCCCTACTGGACAAAG -3'
(R):5'- AGAGTGTTAGTGCCATCACC -3'
Posted On 2022-10-06