Incidental Mutation 'R9660:Nup210l'
ID 727499
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock # R9660 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 90104132-90212048 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90198095 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1517 (T1517A)
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably benign
Transcript: ENSMUST00000029548
AA Change: T1517A

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: T1517A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200410
AA Change: T1517A

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: T1517A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,252,255 M819V probably benign Het
Abca5 T A 11: 110,277,422 T1461S possibly damaging Het
Actl6b C T 5: 137,564,504 R161C probably damaging Het
Aoc3 C G 11: 101,331,088 P50R possibly damaging Het
Atr G A 9: 95,914,997 A1698T probably benign Het
Caml T A 13: 55,631,857 S248T possibly damaging Het
Cdh11 C T 8: 102,658,247 G399S possibly damaging Het
Chrna10 G T 7: 102,112,209 L392I probably benign Het
Clip2 C T 5: 134,504,762 R487Q probably benign Het
Copg1 A G 6: 87,902,243 I424V probably damaging Het
Cwh43 A T 5: 73,408,286 N65Y possibly damaging Het
Defb1 A G 8: 21,794,470 Y35C probably damaging Het
Disp2 T C 2: 118,790,146 V453A probably benign Het
Dpp9 A G 17: 56,187,458 Y834H probably damaging Het
Emsy A G 7: 98,613,078 I598T possibly damaging Het
Entpd2 C T 2: 25,398,141 R126C probably damaging Het
Fbxl17 A T 17: 63,499,431 M196K probably benign Het
Gcc1 T C 6: 28,420,545 R258G probably damaging Het
Gga2 A T 7: 122,007,271 M157K possibly damaging Het
Gna11 T C 10: 81,535,084 N106S probably benign Het
Gtf3c1 A C 7: 125,663,027 S1116A possibly damaging Het
Gucy2d C A 7: 98,449,857 D294E probably damaging Het
Igkv12-46 G T 6: 69,764,983 P4T possibly damaging Het
Iqcf5 A T 9: 106,515,969 I142L probably damaging Het
Klhdc9 A G 1: 171,359,789 S214P probably damaging Het
Kmt2e T C 5: 23,478,619 Y292H probably damaging Het
Lgr6 A G 1: 134,987,507 L778P probably damaging Het
Lrrk2 A G 15: 91,734,025 N909S probably benign Het
Ly75 A G 2: 60,323,840 S1088P probably damaging Het
Mei1 G A 15: 82,081,897 G240D Het
Miox A T 15: 89,334,500 probably benign Het
Myo1e A G 9: 70,316,642 Y128C probably damaging Het
Necab2 T C 8: 119,462,664 V191A possibly damaging Het
Nlrp9a T A 7: 26,557,490 Y178N probably damaging Het
Nr4a3 A G 4: 48,051,353 T36A probably benign Het
Olfr1197 T C 2: 88,728,798 K267R probably damaging Het
Olfr1198 T C 2: 88,746,528 Y120C probably damaging Het
Olfr1284 T G 2: 111,379,894 I298R probably damaging Het
Olfr573-ps1 C T 7: 102,942,052 C175Y probably damaging Het
Pcnx2 A T 8: 125,760,853 S1804T probably damaging Het
Pdcd11 T A 19: 47,093,752 V35D possibly damaging Het
Pde10a C A 17: 8,951,538 T347K probably damaging Het
Rcc1l A G 5: 134,154,138 Y432H probably benign Het
Rgs22 A T 15: 36,040,710 V1001E probably benign Het
Ripor3 T A 2: 167,989,726 D385V probably damaging Het
Rrbp1 T C 2: 143,989,258 K330E probably damaging Het
Ryr3 T G 2: 112,833,729 D1759A probably benign Het
Scube3 A G 17: 28,152,440 D43G probably benign Het
Sec24b A G 3: 129,996,773 I701T probably damaging Het
Setd5 G T 6: 113,151,405 V1440L probably benign Het
Sik3 A G 9: 46,194,844 K337E possibly damaging Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc1a6 T A 10: 78,812,864 M473K probably benign Het
Spag16 A G 1: 69,923,683 R330G probably benign Het
Spag6 C A 2: 18,699,236 Q32K probably benign Het
Sspo G A 6: 48,455,773 G861D probably damaging Het
Togaram2 T A 17: 71,717,370 S850T probably damaging Het
Trbv15 A T 6: 41,141,616 E102V possibly damaging Het
Trim43b G T 9: 89,091,342 H113N probably benign Het
Trpm2 T A 10: 77,930,555 I877L probably benign Het
Ttn T C 2: 76,768,808 I19286V probably benign Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Tubb6 A G 18: 67,401,601 H190R probably benign Het
Vmn1r214 T C 13: 23,034,837 V167A probably benign Het
Vwf C A 6: 125,591,707 L398I possibly damaging Het
Zfp9 G T 6: 118,466,890 A58E probably benign Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90190849 splice site probably benign
IGL00813:Nup210l APN 3 90132418 missense probably benign 0.00
IGL01375:Nup210l APN 3 90159893 missense probably damaging 0.96
IGL01731:Nup210l APN 3 90154566 missense probably damaging 1.00
IGL01786:Nup210l APN 3 90122776 nonsense probably null
IGL01958:Nup210l APN 3 90203924 missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90180213 critical splice donor site probably null
IGL02120:Nup210l APN 3 90136862 missense probably damaging 1.00
IGL02313:Nup210l APN 3 90122792 missense probably damaging 1.00
IGL02336:Nup210l APN 3 90181552 critical splice donor site probably null
IGL02348:Nup210l APN 3 90104164 utr 5 prime probably benign
IGL02372:Nup210l APN 3 90201971 missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90124230 missense probably damaging 1.00
IGL02559:Nup210l APN 3 90159953 missense probably benign 0.02
IGL02738:Nup210l APN 3 90136850 missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90189545 missense probably damaging 1.00
IGL03257:Nup210l APN 3 90180148 critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90170044 missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90190887 missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R0040:Nup210l UTSW 3 90181905 missense probably damaging 1.00
R0083:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0090:Nup210l UTSW 3 90211779 missense probably benign 0.00
R0108:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0142:Nup210l UTSW 3 90172113 missense probably damaging 1.00
R0306:Nup210l UTSW 3 90207368 missense probably benign 0.13
R0332:Nup210l UTSW 3 90132309 splice site probably benign
R0346:Nup210l UTSW 3 90189438 missense probably damaging 1.00
R0463:Nup210l UTSW 3 90180211 missense probably null 1.00
R0622:Nup210l UTSW 3 90167740 missense probably damaging 0.98
R0765:Nup210l UTSW 3 90119877 missense probably damaging 0.99
R0990:Nup210l UTSW 3 90211925 missense probably benign 0.00
R1014:Nup210l UTSW 3 90170048 missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90192940 splice site probably benign
R1177:Nup210l UTSW 3 90202003 missense probably benign 0.11
R1183:Nup210l UTSW 3 90159945 missense probably benign 0.04
R1188:Nup210l UTSW 3 90198179 missense probably benign 0.16
R1457:Nup210l UTSW 3 90190972 missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90170562 missense probably benign
R1627:Nup210l UTSW 3 90144169 missense probably benign 0.15
R1778:Nup210l UTSW 3 90189486 missense probably damaging 0.99
R1827:Nup210l UTSW 3 90154557 missense probably damaging 1.00
R1843:Nup210l UTSW 3 90172086 missense probably damaging 0.96
R1858:Nup210l UTSW 3 90154499 missense probably damaging 0.97
R1942:Nup210l UTSW 3 90151237 missense probably benign 0.01
R2015:Nup210l UTSW 3 90185432 missense probably damaging 1.00
R2113:Nup210l UTSW 3 90190974 missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90181545 missense probably damaging 1.00
R3736:Nup210l UTSW 3 90120013 missense probably damaging 1.00
R3740:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3741:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3742:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3771:Nup210l UTSW 3 90119894 nonsense probably null
R3773:Nup210l UTSW 3 90119894 nonsense probably null
R3879:Nup210l UTSW 3 90185473 missense probably damaging 1.00
R3882:Nup210l UTSW 3 90124210 missense probably benign 0.19
R3953:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R4290:Nup210l UTSW 3 90207326 missense probably benign 0.00
R4328:Nup210l UTSW 3 90175835 splice site probably null
R4629:Nup210l UTSW 3 90167875 missense probably benign 0.21
R4629:Nup210l UTSW 3 90190874 nonsense probably null
R4897:Nup210l UTSW 3 90193071 missense probably damaging 1.00
R4906:Nup210l UTSW 3 90170030 missense probably benign 0.06
R4966:Nup210l UTSW 3 90106901 missense probably benign 0.00
R5004:Nup210l UTSW 3 90180165 nonsense probably null
R5237:Nup210l UTSW 3 90180198 missense probably benign 0.00
R5499:Nup210l UTSW 3 90174370 missense probably damaging 1.00
R5522:Nup210l UTSW 3 90154665 missense probably benign 0.10
R5627:Nup210l UTSW 3 90144250 missense probably damaging 0.97
R5678:Nup210l UTSW 3 90190959 missense probably damaging 0.99
R5726:Nup210l UTSW 3 90129207 splice site probably null
R5792:Nup210l UTSW 3 90199857 missense probably damaging 1.00
R6129:Nup210l UTSW 3 90104176 missense probably benign 0.00
R6272:Nup210l UTSW 3 90170024 missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90119909 nonsense probably null
R6293:Nup210l UTSW 3 90115064 missense probably damaging 1.00
R6446:Nup210l UTSW 3 90172068 missense probably damaging 1.00
R6698:Nup210l UTSW 3 90182508 missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90136924 missense probably benign 0.01
R6895:Nup210l UTSW 3 90159924 missense probably damaging 0.97
R6899:Nup210l UTSW 3 90167897 missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90154566 missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90119927 missense probably benign 0.04
R7038:Nup210l UTSW 3 90159947 missense probably damaging 1.00
R7273:Nup210l UTSW 3 90118547 missense probably benign 0.04
R7450:Nup210l UTSW 3 90115188 critical splice donor site probably null
R7514:Nup210l UTSW 3 90210459 critical splice donor site probably null
R7658:Nup210l UTSW 3 90211993 missense probably benign 0.43
R7735:Nup210l UTSW 3 90185576 missense probably damaging 1.00
R7772:Nup210l UTSW 3 90159926 missense probably damaging 1.00
R7800:Nup210l UTSW 3 90134597 missense probably damaging 1.00
R7840:Nup210l UTSW 3 90122729 missense probably benign 0.08
R7847:Nup210l UTSW 3 90151123 missense probably benign
R7848:Nup210l UTSW 3 90203905 missense probably benign 0.01
R8084:Nup210l UTSW 3 90136058 missense probably benign 0.15
R8121:Nup210l UTSW 3 90115121 missense probably damaging 1.00
R8421:Nup210l UTSW 3 90203867 missense probably damaging 1.00
R8458:Nup210l UTSW 3 90185567 missense probably null 1.00
R8701:Nup210l UTSW 3 90122814 missense probably benign 0.41
R8720:Nup210l UTSW 3 90210374 missense probably benign 0.00
R8770:Nup210l UTSW 3 90118543 missense probably damaging 1.00
R8896:Nup210l UTSW 3 90118625 missense probably damaging 1.00
R9033:Nup210l UTSW 3 90198089 missense probably benign
R9371:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9373:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9381:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9426:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9427:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9501:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9523:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9574:Nup210l UTSW 3 90210386 missense probably benign
R9612:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9654:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9660:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9662:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9682:Nup210l UTSW 3 90144162 missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9750:Nup210l UTSW 3 90210352 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGCTGGCATGATATAGGAAG -3'
(R):5'- TGTTAGCAAATGCACTTCCAC -3'

Sequencing Primer
(F):5'- TATAGGAAGGGGAATCTGACATTC -3'
(R):5'- GTTAGCAAATGCACTTCCACCCTAG -3'
Posted On 2022-10-06