Incidental Mutation 'R9660:Abca14'
ID 727521
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9660 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119851478 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 819 (M819V)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
AlphaFold E9Q8F8
Predicted Effect probably benign
Transcript: ENSMUST00000084640
AA Change: M819V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: M819V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,168,248 (GRCm39) T1461S possibly damaging Het
Actl6b C T 5: 137,562,766 (GRCm39) R161C probably damaging Het
Aoc3 C G 11: 101,221,914 (GRCm39) P50R possibly damaging Het
Atr G A 9: 95,797,050 (GRCm39) A1698T probably benign Het
Caml T A 13: 55,779,670 (GRCm39) S248T possibly damaging Het
Cdh11 C T 8: 103,384,879 (GRCm39) G399S possibly damaging Het
Chrna10 G T 7: 101,761,416 (GRCm39) L392I probably benign Het
Clip2 C T 5: 134,533,616 (GRCm39) R487Q probably benign Het
Copg1 A G 6: 87,879,225 (GRCm39) I424V probably damaging Het
Cwh43 A T 5: 73,565,629 (GRCm39) N65Y possibly damaging Het
Defb1 A G 8: 22,284,486 (GRCm39) Y35C probably damaging Het
Disp2 T C 2: 118,620,627 (GRCm39) V453A probably benign Het
Dpp9 A G 17: 56,494,458 (GRCm39) Y834H probably damaging Het
Emsy A G 7: 98,262,285 (GRCm39) I598T possibly damaging Het
Entpd2 C T 2: 25,288,153 (GRCm39) R126C probably damaging Het
Fbxl17 A T 17: 63,806,426 (GRCm39) M196K probably benign Het
Gcc1 T C 6: 28,420,544 (GRCm39) R258G probably damaging Het
Gga2 A T 7: 121,606,494 (GRCm39) M157K possibly damaging Het
Gna11 T C 10: 81,370,918 (GRCm39) N106S probably benign Het
Gtf3c1 A C 7: 125,262,199 (GRCm39) S1116A possibly damaging Het
Gucy2d C A 7: 98,099,064 (GRCm39) D294E probably damaging Het
Igkv12-46 G T 6: 69,741,967 (GRCm39) P4T possibly damaging Het
Iqcf5 A T 9: 106,393,168 (GRCm39) I142L probably damaging Het
Klhdc9 A G 1: 171,187,357 (GRCm39) S214P probably damaging Het
Kmt2e T C 5: 23,683,617 (GRCm39) Y292H probably damaging Het
Lgr6 A G 1: 134,915,245 (GRCm39) L778P probably damaging Het
Lrrk2 A G 15: 91,618,228 (GRCm39) N909S probably benign Het
Ly75 A G 2: 60,154,184 (GRCm39) S1088P probably damaging Het
Mei1 G A 15: 81,966,098 (GRCm39) G240D Het
Miox A T 15: 89,218,703 (GRCm39) probably benign Het
Myo1e A G 9: 70,223,924 (GRCm39) Y128C probably damaging Het
Necab2 T C 8: 120,189,403 (GRCm39) V191A possibly damaging Het
Nlrp9a T A 7: 26,256,915 (GRCm39) Y178N probably damaging Het
Nr4a3 A G 4: 48,051,353 (GRCm39) T36A probably benign Het
Nup210l A G 3: 90,105,402 (GRCm39) T1517A probably benign Het
Nup210l C T 3: 90,107,173 (GRCm39) P1570L probably benign Het
Or4a27 T C 2: 88,559,142 (GRCm39) K267R probably damaging Het
Or4g17 T G 2: 111,210,239 (GRCm39) I298R probably damaging Het
Or4p23 T C 2: 88,576,872 (GRCm39) Y120C probably damaging Het
Or51h7 C T 7: 102,591,259 (GRCm39) C175Y probably damaging Het
Pcnx2 A T 8: 126,487,592 (GRCm39) S1804T probably damaging Het
Pdcd11 T A 19: 47,082,191 (GRCm39) V35D possibly damaging Het
Pde10a C A 17: 9,170,370 (GRCm39) T347K probably damaging Het
Rcc1l A G 5: 134,182,977 (GRCm39) Y432H probably benign Het
Rgs22 A T 15: 36,040,856 (GRCm39) V1001E probably benign Het
Ripor3 T A 2: 167,831,646 (GRCm39) D385V probably damaging Het
Rrbp1 T C 2: 143,831,178 (GRCm39) K330E probably damaging Het
Ryr3 T G 2: 112,664,074 (GRCm39) D1759A probably benign Het
Scube3 A G 17: 28,371,414 (GRCm39) D43G probably benign Het
Sec24b A G 3: 129,790,422 (GRCm39) I701T probably damaging Het
Setd5 G T 6: 113,128,366 (GRCm39) V1440L probably benign Het
Sik3 A G 9: 46,106,142 (GRCm39) K337E possibly damaging Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc1a6 T A 10: 78,648,698 (GRCm39) M473K probably benign Het
Spag16 A G 1: 69,962,842 (GRCm39) R330G probably benign Het
Spag6 C A 2: 18,704,047 (GRCm39) Q32K probably benign Het
Sspo G A 6: 48,432,707 (GRCm39) G861D probably damaging Het
Togaram2 T A 17: 72,024,365 (GRCm39) S850T probably damaging Het
Trbv15 A T 6: 41,118,550 (GRCm39) E102V possibly damaging Het
Trim43b G T 9: 88,973,395 (GRCm39) H113N probably benign Het
Trpm2 T A 10: 77,766,389 (GRCm39) I877L probably benign Het
Ttn T C 2: 76,599,152 (GRCm39) I19286V probably benign Het
Ttn C T 2: 76,715,357 (GRCm39) E7912K unknown Het
Tubb6 A G 18: 67,534,671 (GRCm39) H190R probably benign Het
Vmn1r214 T C 13: 23,219,007 (GRCm39) V167A probably benign Het
Vwf C A 6: 125,568,670 (GRCm39) L398I possibly damaging Het
Zfp9 G T 6: 118,443,851 (GRCm39) A58E probably benign Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0611:Abca14 UTSW 7 119,851,479 (GRCm39) missense possibly damaging 0.63
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1551:Abca14 UTSW 7 119,918,101 (GRCm39) missense probably benign 0.10
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1892:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R1958:Abca14 UTSW 7 119,924,382 (GRCm39) missense probably damaging 0.98
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7220:Abca14 UTSW 7 119,826,667 (GRCm39) missense possibly damaging 0.45
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7296:Abca14 UTSW 7 119,877,534 (GRCm39) missense probably benign
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7315:Abca14 UTSW 7 119,893,341 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8419:Abca14 UTSW 7 119,815,489 (GRCm39) missense probably benign 0.08
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8889:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8903:Abca14 UTSW 7 119,815,526 (GRCm39) missense probably damaging 0.98
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9388:Abca14 UTSW 7 119,882,261 (GRCm39) missense probably benign 0.01
R9445:Abca14 UTSW 7 119,877,691 (GRCm39) missense probably benign 0.05
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9696:Abca14 UTSW 7 119,888,734 (GRCm39) missense possibly damaging 0.59
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGACACATGAATTGCACTGC -3'
(R):5'- ATGCTGGAAATCAGAGCACAC -3'

Sequencing Primer
(F):5'- CATGAATTGCACTGCTCAGG -3'
(R):5'- TCAGAGCACACATGAGGTCGC -3'
Posted On 2022-10-06