Incidental Mutation 'R9661:Fer1l4'
ID 727556
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Name fer-1 like family member 4
Synonyms 9130402C12Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9661 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 155861059-155894867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 155862336 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 1779 (A1779V)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006035] [ENSMUST00000088650] [ENSMUST00000109611]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006035
SMART Domains Protein: ENSMUSP00000006035
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:ERGIC_N 6 101 2.2e-38 PFAM
Pfam:COPIIcoated_ERV 145 363 6.2e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088650
SMART Domains Protein: ENSMUSP00000086025
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:ERGIC_N 7 97 9e-35 PFAM
Pfam:COPIIcoated_ERV 145 374 7e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109611
AA Change: A1779V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: A1779V

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142859
SMART Domains Protein: ENSMUSP00000115912
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:COPIIcoated_ERV 74 246 1.9e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155370
SMART Domains Protein: ENSMUSP00000119051
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:COPIIcoated_ERV 21 235 1e-95 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,645,451 (GRCm39) H445Q possibly damaging Het
Aadacl4 C A 4: 144,340,287 (GRCm39) P4Q probably damaging Het
Adgre1 A G 17: 57,748,368 (GRCm39) T523A possibly damaging Het
Arhgap32 A G 9: 32,168,531 (GRCm39) E838G probably benign Het
Atad5 G T 11: 79,980,542 (GRCm39) probably benign Het
Card10 C T 15: 78,683,318 (GRCm39) R275H probably damaging Het
Cdh16 A G 8: 105,345,612 (GRCm39) V327A probably benign Het
Clip2 C T 5: 134,533,616 (GRCm39) R487Q probably benign Het
Cttnbp2 T A 6: 18,429,151 (GRCm39) Q159L Het
D630003M21Rik A G 2: 158,047,673 (GRCm39) L732P possibly damaging Het
Dgcr8 T C 16: 18,098,579 (GRCm39) I308V possibly damaging Het
Dhx9 A G 1: 153,340,393 (GRCm39) F702L probably damaging Het
Dpy19l1 T C 9: 24,386,730 (GRCm39) Y188C probably damaging Het
Eea1 T C 10: 95,862,742 (GRCm39) L888S probably benign Het
Elmo1 T C 13: 20,469,531 (GRCm39) probably null Het
Fam186a T A 15: 99,842,492 (GRCm39) I1251F possibly damaging Het
Fgfrl1 C T 5: 108,853,841 (GRCm39) T407I probably benign Het
Gkn1 T C 6: 87,325,173 (GRCm39) K79E probably damaging Het
Gm11564 C T 11: 99,706,247 (GRCm39) R61H unknown Het
Gpr107 T C 2: 31,057,075 (GRCm39) F56L probably benign Het
H2-T22 T C 17: 36,353,371 (GRCm39) probably benign Het
Hs1bp3 T C 12: 8,367,940 (GRCm39) V63A probably damaging Het
Htr6 A G 4: 138,801,963 (GRCm39) I37T probably damaging Het
Kifc5b T C 17: 27,140,836 (GRCm39) probably null Het
Lrfn2 T C 17: 49,403,650 (GRCm39) I591T probably benign Het
Lrrc49 A T 9: 60,573,582 (GRCm39) I300N probably damaging Het
Lyst A G 13: 13,808,779 (GRCm39) T150A probably benign Het
Myh11 T C 16: 14,041,857 (GRCm39) Q722R Het
Nek9 T C 12: 85,361,253 (GRCm39) Q484R possibly damaging Het
Nfs1 A T 2: 155,970,473 (GRCm39) V280E probably damaging Het
Notch3 T A 17: 32,373,792 (GRCm39) D472V probably damaging Het
Nt5c1b T C 12: 10,425,450 (GRCm39) V273A probably damaging Het
Nudt12 T C 17: 59,316,981 (GRCm39) D222G probably benign Het
Nup98 G A 7: 101,782,019 (GRCm39) Q1204* probably null Het
Nwd2 A T 5: 63,957,780 (GRCm39) Y370F probably damaging Het
Oas3 A T 5: 120,904,230 (GRCm39) I548N unknown Het
Ogfr A T 2: 180,233,431 (GRCm39) N78Y probably damaging Het
Or10ak11 A T 4: 118,687,526 (GRCm39) L36Q probably benign Het
Prkcq A T 2: 11,250,141 (GRCm39) K153* probably null Het
Ptpdc1 T A 13: 48,739,610 (GRCm39) N607I probably benign Het
Rab5c G T 11: 100,606,917 (GRCm39) Q221K probably benign Het
Ret G A 6: 118,150,437 (GRCm39) T693I probably benign Het
Rnf20 A G 4: 49,654,556 (GRCm39) E871G probably damaging Het
Rtl1 G T 12: 109,557,346 (GRCm39) P1498T possibly damaging Het
Septin9 C G 11: 117,245,751 (GRCm39) R458G possibly damaging Het
Sh2d2a T C 3: 87,756,788 (GRCm39) probably null Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc16a4 T A 3: 107,213,359 (GRCm39) D451E probably benign Het
Slc36a3 A G 11: 55,015,984 (GRCm39) F390S probably benign Het
Slc4a2 T A 5: 24,640,005 (GRCm39) M576K probably damaging Het
Smim14 T C 5: 65,610,533 (GRCm39) H88R possibly damaging Het
Spata31e5 G T 1: 28,816,536 (GRCm39) H499N probably benign Het
Sspo C T 6: 48,455,272 (GRCm39) Q3045* probably null Het
Supt7l C A 5: 31,680,403 (GRCm39) R3M probably damaging Het
Tjap1 A G 17: 46,571,092 (GRCm39) W132R probably damaging Het
Tmem26 T A 10: 68,559,838 (GRCm39) W37R probably damaging Het
Tut7 T C 13: 59,937,332 (GRCm39) D1155G probably damaging Het
Vmn1r119 C T 7: 20,746,224 (GRCm39) V53M possibly damaging Het
Vmn2r54 A T 7: 12,349,166 (GRCm39) N805K probably benign Het
Zfp638 T C 6: 83,923,320 (GRCm39) V706A probably damaging Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 155,861,840 (GRCm39) nonsense probably null
IGL01025:Fer1l4 APN 2 155,894,105 (GRCm39) missense probably benign 0.41
IGL01103:Fer1l4 APN 2 155,886,361 (GRCm39) critical splice donor site probably null
IGL01322:Fer1l4 APN 2 155,862,259 (GRCm39) splice site probably null
IGL01391:Fer1l4 APN 2 155,878,376 (GRCm39) missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 155,890,371 (GRCm39) missense probably benign
IGL02267:Fer1l4 APN 2 155,873,172 (GRCm39) missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 155,861,458 (GRCm39) missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 155,887,348 (GRCm39) missense probably benign 0.04
IGL02423:Fer1l4 APN 2 155,894,827 (GRCm39) missense probably benign 0.04
IGL02596:Fer1l4 APN 2 155,881,052 (GRCm39) missense probably benign
IGL02612:Fer1l4 APN 2 155,889,848 (GRCm39) missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 155,871,635 (GRCm39) missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 155,887,648 (GRCm39) missense probably benign
IGL03035:Fer1l4 APN 2 155,864,526 (GRCm39) missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 155,881,286 (GRCm39) unclassified probably benign
IGL03201:Fer1l4 APN 2 155,886,650 (GRCm39) missense probably benign 0.32
IGL03349:Fer1l4 APN 2 155,886,654 (GRCm39) nonsense probably null
R0033:Fer1l4 UTSW 2 155,866,026 (GRCm39) splice site probably benign
R0356:Fer1l4 UTSW 2 155,865,930 (GRCm39) missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 155,894,806 (GRCm39) missense probably benign 0.43
R0504:Fer1l4 UTSW 2 155,894,115 (GRCm39) missense probably benign 0.36
R0731:Fer1l4 UTSW 2 155,865,990 (GRCm39) missense probably benign 0.17
R0800:Fer1l4 UTSW 2 155,887,583 (GRCm39) missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 155,861,233 (GRCm39) missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 155,891,398 (GRCm39) critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 155,888,169 (GRCm39) missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 155,887,553 (GRCm39) missense probably benign 0.00
R1657:Fer1l4 UTSW 2 155,877,518 (GRCm39) missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 155,871,605 (GRCm39) missense probably benign 0.14
R1816:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 155,890,194 (GRCm39) missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 155,881,038 (GRCm39) missense probably benign 0.00
R2219:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 155,894,120 (GRCm39) missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 155,876,968 (GRCm39) missense probably benign 0.01
R3806:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 155,862,309 (GRCm39) missense probably benign 0.37
R4274:Fer1l4 UTSW 2 155,862,464 (GRCm39) missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 155,878,559 (GRCm39) missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 155,889,007 (GRCm39) missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 155,887,543 (GRCm39) missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4915:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4917:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4918:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4941:Fer1l4 UTSW 2 155,887,009 (GRCm39) missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 155,891,386 (GRCm39) missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 155,879,286 (GRCm39) nonsense probably null
R5441:Fer1l4 UTSW 2 155,865,177 (GRCm39) missense probably benign 0.00
R5555:Fer1l4 UTSW 2 155,890,109 (GRCm39) missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 155,893,913 (GRCm39) missense probably benign 0.01
R6125:Fer1l4 UTSW 2 155,888,907 (GRCm39) missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 155,890,211 (GRCm39) missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 155,866,902 (GRCm39) missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 155,888,091 (GRCm39) missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 155,871,188 (GRCm39) missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 155,866,660 (GRCm39) missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 155,890,170 (GRCm39) missense probably benign 0.08
R6490:Fer1l4 UTSW 2 155,889,834 (GRCm39) missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 155,887,390 (GRCm39) missense probably benign 0.02
R6516:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 155,889,785 (GRCm39) critical splice donor site probably null
R6740:Fer1l4 UTSW 2 155,873,142 (GRCm39) missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 155,878,650 (GRCm39) missense probably benign 0.05
R7121:Fer1l4 UTSW 2 155,886,477 (GRCm39) missense probably benign 0.13
R7132:Fer1l4 UTSW 2 155,887,546 (GRCm39) missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 155,862,669 (GRCm39) nonsense probably null
R7631:Fer1l4 UTSW 2 155,890,195 (GRCm39) missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 155,862,351 (GRCm39) missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 155,890,854 (GRCm39) missense probably benign
R8021:Fer1l4 UTSW 2 155,864,511 (GRCm39) missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 155,866,555 (GRCm39) missense probably benign 0.03
R8171:Fer1l4 UTSW 2 155,890,151 (GRCm39) missense probably benign 0.29
R8241:Fer1l4 UTSW 2 155,891,585 (GRCm39) missense probably benign
R8245:Fer1l4 UTSW 2 155,886,934 (GRCm39) critical splice donor site probably null
R8280:Fer1l4 UTSW 2 155,891,620 (GRCm39) missense probably damaging 1.00
R8369:Fer1l4 UTSW 2 155,861,680 (GRCm39) missense probably benign 0.17
R8403:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense possibly damaging 0.88
R8702:Fer1l4 UTSW 2 155,861,310 (GRCm39) missense probably benign 0.00
R8804:Fer1l4 UTSW 2 155,893,914 (GRCm39) missense probably benign 0.28
R8814:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense probably benign 0.04
R8817:Fer1l4 UTSW 2 155,890,143 (GRCm39) missense probably damaging 0.99
R9325:Fer1l4 UTSW 2 155,877,934 (GRCm39) missense probably damaging 1.00
R9342:Fer1l4 UTSW 2 155,877,196 (GRCm39) missense probably benign 0.08
R9527:Fer1l4 UTSW 2 155,871,617 (GRCm39) missense probably damaging 0.96
RF030:Fer1l4 UTSW 2 155,887,449 (GRCm39) small deletion probably benign
X0063:Fer1l4 UTSW 2 155,876,931 (GRCm39) missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 155,890,349 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTGAAATCAACAGGATTCAAGG -3'
(R):5'- AGCCCTGATACCCATCTTGC -3'

Sequencing Primer
(F):5'- TCAACAGGATTCAAGGTTAGAATTC -3'
(R):5'- GATACCCATCTTGCCCTGG -3'
Posted On 2022-10-06