Incidental Mutation 'R9661:Ret'
ID 727578
Institutional Source Beutler Lab
Gene Symbol Ret
Ensembl Gene ENSMUSG00000030110
Gene Name ret proto-oncogene
Synonyms RET9, c-Ret, RET51
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.825) question?
Stock # R9661 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 118128706-118174679 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 118150437 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 693 (T693I)
Ref Sequence ENSEMBL: ENSMUSP00000032201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032201] [ENSMUST00000088790]
AlphaFold P35546
PDB Structure Crystal Structure of Dok1 PTB Domain Complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000032201
AA Change: T693I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032201
Gene: ENSMUSG00000030110
AA Change: T693I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088790
AA Change: T693I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086169
Gene: ENSMUSG00000030110
AA Change: T693I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 191 271 1.11e-1 SMART
low complexity region 638 656 N/A INTRINSIC
TyrKc 725 1006 3.58e-148 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some point mutations or knock-out alleles exhibit premature lethality, defects in neurogenesis, and abnormal kidney, ureter, ovary, muscle, and intestine morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,645,451 (GRCm39) H445Q possibly damaging Het
Aadacl4 C A 4: 144,340,287 (GRCm39) P4Q probably damaging Het
Adgre1 A G 17: 57,748,368 (GRCm39) T523A possibly damaging Het
Arhgap32 A G 9: 32,168,531 (GRCm39) E838G probably benign Het
Atad5 G T 11: 79,980,542 (GRCm39) probably benign Het
Card10 C T 15: 78,683,318 (GRCm39) R275H probably damaging Het
Cdh16 A G 8: 105,345,612 (GRCm39) V327A probably benign Het
Clip2 C T 5: 134,533,616 (GRCm39) R487Q probably benign Het
Cttnbp2 T A 6: 18,429,151 (GRCm39) Q159L Het
D630003M21Rik A G 2: 158,047,673 (GRCm39) L732P possibly damaging Het
Dgcr8 T C 16: 18,098,579 (GRCm39) I308V possibly damaging Het
Dhx9 A G 1: 153,340,393 (GRCm39) F702L probably damaging Het
Dpy19l1 T C 9: 24,386,730 (GRCm39) Y188C probably damaging Het
Eea1 T C 10: 95,862,742 (GRCm39) L888S probably benign Het
Elmo1 T C 13: 20,469,531 (GRCm39) probably null Het
Fam186a T A 15: 99,842,492 (GRCm39) I1251F possibly damaging Het
Fer1l4 G A 2: 155,862,336 (GRCm39) A1779V probably damaging Het
Fgfrl1 C T 5: 108,853,841 (GRCm39) T407I probably benign Het
Gkn1 T C 6: 87,325,173 (GRCm39) K79E probably damaging Het
Gm11564 C T 11: 99,706,247 (GRCm39) R61H unknown Het
Gpr107 T C 2: 31,057,075 (GRCm39) F56L probably benign Het
H2-T22 T C 17: 36,353,371 (GRCm39) probably benign Het
Hs1bp3 T C 12: 8,367,940 (GRCm39) V63A probably damaging Het
Htr6 A G 4: 138,801,963 (GRCm39) I37T probably damaging Het
Kifc5b T C 17: 27,140,836 (GRCm39) probably null Het
Lrfn2 T C 17: 49,403,650 (GRCm39) I591T probably benign Het
Lrrc49 A T 9: 60,573,582 (GRCm39) I300N probably damaging Het
Lyst A G 13: 13,808,779 (GRCm39) T150A probably benign Het
Myh11 T C 16: 14,041,857 (GRCm39) Q722R Het
Nek9 T C 12: 85,361,253 (GRCm39) Q484R possibly damaging Het
Nfs1 A T 2: 155,970,473 (GRCm39) V280E probably damaging Het
Notch3 T A 17: 32,373,792 (GRCm39) D472V probably damaging Het
Nt5c1b T C 12: 10,425,450 (GRCm39) V273A probably damaging Het
Nudt12 T C 17: 59,316,981 (GRCm39) D222G probably benign Het
Nup98 G A 7: 101,782,019 (GRCm39) Q1204* probably null Het
Nwd2 A T 5: 63,957,780 (GRCm39) Y370F probably damaging Het
Oas3 A T 5: 120,904,230 (GRCm39) I548N unknown Het
Ogfr A T 2: 180,233,431 (GRCm39) N78Y probably damaging Het
Or10ak11 A T 4: 118,687,526 (GRCm39) L36Q probably benign Het
Prkcq A T 2: 11,250,141 (GRCm39) K153* probably null Het
Ptpdc1 T A 13: 48,739,610 (GRCm39) N607I probably benign Het
Rab5c G T 11: 100,606,917 (GRCm39) Q221K probably benign Het
Rnf20 A G 4: 49,654,556 (GRCm39) E871G probably damaging Het
Rtl1 G T 12: 109,557,346 (GRCm39) P1498T possibly damaging Het
Septin9 C G 11: 117,245,751 (GRCm39) R458G possibly damaging Het
Sh2d2a T C 3: 87,756,788 (GRCm39) probably null Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc16a4 T A 3: 107,213,359 (GRCm39) D451E probably benign Het
Slc36a3 A G 11: 55,015,984 (GRCm39) F390S probably benign Het
Slc4a2 T A 5: 24,640,005 (GRCm39) M576K probably damaging Het
Smim14 T C 5: 65,610,533 (GRCm39) H88R possibly damaging Het
Spata31e5 G T 1: 28,816,536 (GRCm39) H499N probably benign Het
Sspo C T 6: 48,455,272 (GRCm39) Q3045* probably null Het
Supt7l C A 5: 31,680,403 (GRCm39) R3M probably damaging Het
Tjap1 A G 17: 46,571,092 (GRCm39) W132R probably damaging Het
Tmem26 T A 10: 68,559,838 (GRCm39) W37R probably damaging Het
Tut7 T C 13: 59,937,332 (GRCm39) D1155G probably damaging Het
Vmn1r119 C T 7: 20,746,224 (GRCm39) V53M possibly damaging Het
Vmn2r54 A T 7: 12,349,166 (GRCm39) N805K probably benign Het
Zfp638 T C 6: 83,923,320 (GRCm39) V706A probably damaging Het
Other mutations in Ret
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02255:Ret APN 6 118,152,081 (GRCm39) splice site probably null
IGL02445:Ret APN 6 118,158,860 (GRCm39) missense probably damaging 0.98
IGL02754:Ret APN 6 118,153,213 (GRCm39) missense probably benign 0.03
IGL02828:Ret APN 6 118,153,168 (GRCm39) missense probably benign 0.00
IGL03058:Ret APN 6 118,152,028 (GRCm39) missense probably damaging 1.00
PIT4151001:Ret UTSW 6 118,141,702 (GRCm39) missense probably benign 0.04
R0126:Ret UTSW 6 118,142,956 (GRCm39) splice site probably benign
R0555:Ret UTSW 6 118,155,571 (GRCm39) missense probably damaging 0.96
R1168:Ret UTSW 6 118,150,519 (GRCm39) missense possibly damaging 0.94
R1829:Ret UTSW 6 118,130,912 (GRCm39) missense probably damaging 0.99
R2020:Ret UTSW 6 118,157,343 (GRCm39) missense possibly damaging 0.63
R4082:Ret UTSW 6 118,130,927 (GRCm39) missense possibly damaging 0.81
R4732:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R4733:Ret UTSW 6 118,140,154 (GRCm39) missense possibly damaging 0.77
R5356:Ret UTSW 6 118,174,079 (GRCm39) missense possibly damaging 0.73
R5401:Ret UTSW 6 118,158,936 (GRCm39) missense probably benign 0.05
R5572:Ret UTSW 6 118,132,392 (GRCm39) missense probably damaging 1.00
R5669:Ret UTSW 6 118,161,204 (GRCm39) missense probably benign
R6058:Ret UTSW 6 118,156,280 (GRCm39) missense probably benign
R6087:Ret UTSW 6 118,153,252 (GRCm39) missense possibly damaging 0.53
R6412:Ret UTSW 6 118,161,245 (GRCm39) missense probably benign 0.00
R6457:Ret UTSW 6 118,150,582 (GRCm39) missense probably benign 0.01
R6884:Ret UTSW 6 118,132,362 (GRCm39) missense probably damaging 1.00
R7035:Ret UTSW 6 118,140,247 (GRCm39) missense probably damaging 1.00
R7112:Ret UTSW 6 118,174,063 (GRCm39) missense possibly damaging 0.96
R7841:Ret UTSW 6 118,132,321 (GRCm39) missense probably damaging 1.00
R7947:Ret UTSW 6 118,151,305 (GRCm39) missense probably benign 0.32
R8539:Ret UTSW 6 118,152,770 (GRCm39) missense possibly damaging 0.60
R8556:Ret UTSW 6 118,146,149 (GRCm39) missense probably damaging 1.00
R8742:Ret UTSW 6 118,155,484 (GRCm39) missense probably damaging 0.99
R8904:Ret UTSW 6 118,157,174 (GRCm39) splice site probably benign
R9051:Ret UTSW 6 118,142,888 (GRCm39) nonsense probably null
R9323:Ret UTSW 6 118,158,975 (GRCm39) missense probably benign 0.00
R9674:Ret UTSW 6 118,130,830 (GRCm39) missense probably damaging 1.00
Z1176:Ret UTSW 6 118,140,168 (GRCm39) missense probably damaging 1.00
Z1177:Ret UTSW 6 118,130,851 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ACGGGAGATCTAGGCAATGC -3'
(R):5'- ACAGTGCAGTCTCTGTCACTC -3'

Sequencing Primer
(F):5'- AATGCCGTATCCACCATCTGTG -3'
(R):5'- AGGCCCACTGTGTGATGC -3'
Posted On 2022-10-06