Incidental Mutation 'R9662:Sgsm1'
ID 727623
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, 2410098H20Rik, D5Bwg1524e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9662 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 113243220-113310786 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 113279231 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 398 (P398L)
Ref Sequence ENSEMBL: ENSMUSP00000046544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209] [ENSMUST00000112324] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000048112
AA Change: P398L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: P398L

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000057209
AA Change: P111L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216
AA Change: P111L

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112324
AA Change: P111L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107943
Gene: ENSMUSG00000042216
AA Change: P111L

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112325
AA Change: P398L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216
AA Change: P398L

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000154248
AA Change: P398L

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216
AA Change: P398L

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 T A 6: 34,832,533 Y698* probably null Het
Arhgef28 C A 13: 97,929,461 G1628V probably benign Het
Bcr T C 10: 75,175,320 V1018A probably benign Het
Cadps T A 14: 12,411,567 E1263V probably benign Het
Cdc14a T A 3: 116,294,835 K446M probably damaging Het
Celf6 C T 9: 59,578,385 A3V unknown Het
Clip2 C T 5: 134,504,762 R487Q probably benign Het
Col1a1 A G 11: 94,945,841 S709G probably benign Het
Dnah17 A T 11: 118,034,340 L3889H probably damaging Het
Dnah2 T C 11: 69,452,937 T2849A probably benign Het
Exog A G 9: 119,452,310 R229G probably benign Het
Fnbp1 T A 2: 31,096,030 K114N probably damaging Het
Gm21149 A T 5: 15,476,359 N35K probably damaging Het
Gm7324 A T 14: 43,714,977 D359V unknown Het
Grin3a A T 4: 49,792,432 S434T possibly damaging Het
H2-Q6 C T 17: 35,425,209 R56C probably damaging Het
Hmgcll1 A T 9: 76,015,115 Y14F probably benign Het
Kcna6 T G 6: 126,738,417 E503A probably benign Het
Kmt2a A G 9: 44,820,131 V2963A unknown Het
Ltk G T 2: 119,751,849 S807* probably null Het
Mars A G 10: 127,300,480 L492P probably damaging Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Myo7a T A 7: 98,098,292 Y111F possibly damaging Het
Ndst3 T A 3: 123,671,466 I286L probably benign Het
Nup210l C T 3: 90,199,866 P1570L probably benign Het
Parg T C 14: 32,250,019 L657S probably damaging Het
Ppip5k1 T C 2: 121,343,573 T356A probably benign Het
Ppp3ca T C 3: 136,877,740 S203P probably damaging Het
Raver1 C T 9: 21,081,254 R293H probably benign Het
Robo2 C T 16: 73,961,678 probably null Het
Slc6a19 A T 13: 73,691,703 C153* probably null Het
Tbx1 T C 16: 18,582,132 H434R unknown Het
Tmem151a C A 19: 5,082,689 R163L probably damaging Het
Ttn A G 2: 76,841,260 V11320A unknown Het
Zfp207 G A 11: 80,395,203 M423I unknown Het
Zfp251 A T 15: 76,853,320 H524Q possibly damaging Het
Zfp318 C T 17: 46,413,457 R2129W probably damaging Het
Zfp763 T A 17: 33,021,813 D14V probably damaging Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
Chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0099:Sgsm1 UTSW 5 113274360 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113273711 nonsense probably null
R1473:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113285404 missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113282656 missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 splice site probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113279635 splice site probably null
R7624:Sgsm1 UTSW 5 113274335 nonsense probably null
R7632:Sgsm1 UTSW 5 113276082 missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113253024 missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113274327 missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113266330 missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113282644 missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113255268 missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113251011 missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113260092 missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113263418 missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113287231 missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113284995 missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113288859 missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113282711 missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113280335 missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113274273 missense unknown
R9377:Sgsm1 UTSW 5 113288875 missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113276032 critical splice donor site probably null
R9722:Sgsm1 UTSW 5 113280341 missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113310552 missense probably benign
Z1177:Sgsm1 UTSW 5 113282710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCCCAAGGGTAACTTTTG -3'
(R):5'- CTTTGGTCACAGCGAGGAAAGG -3'

Sequencing Primer
(F):5'- CCTCCCAAGGGTAACTTTTGGAGTAG -3'
(R):5'- TCTACCGTTGGATGTGCT -3'
Posted On 2022-10-06