Incidental Mutation 'R9663:Ext1'
ID 727715
Institutional Source Beutler Lab
Gene Symbol Ext1
Ensembl Gene ENSMUSG00000061731
Gene Name exostoses (multiple) 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9663 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 53064038-53346159 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53345060 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 102 (S102P)
Ref Sequence ENSEMBL: ENSMUSP00000076505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000133362]
AlphaFold P97464
Predicted Effect probably damaging
Transcript: ENSMUST00000077273
AA Change: S102P

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: S102P

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 29 41 N/A INTRINSIC
Pfam:Exostosin 110 396 6e-64 PFAM
Pfam:Glyco_transf_64 480 729 1.1e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133362
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik A T 3: 92,868,976 N133K probably benign Het
Alkbh6 T C 7: 30,313,946 S161P probably damaging Het
Alppl2 T A 1: 87,088,031 H297L probably benign Het
Angptl2 A G 2: 33,228,219 R2G probably benign Het
Arhgef15 T A 11: 68,954,429 N199I probably damaging Het
Asns A T 6: 7,680,132 I328K probably damaging Het
Atad2 G T 15: 58,108,144 T734K probably benign Het
Capn3 A C 2: 120,486,378 M283L probably benign Het
Catsperd T A 17: 56,653,751 C384S possibly damaging Het
Cd101 A G 3: 101,003,906 V816A probably benign Het
Cd5 T G 19: 10,726,494 D68A probably benign Het
Ceacam18 G A 7: 43,639,340 V172M probably damaging Het
Cfap100 G A 6: 90,409,346 R276C Het
Clip2 C T 5: 134,504,762 R487Q probably benign Het
Creb3l2 A G 6: 37,379,991 V47A probably damaging Het
Crebbp T A 16: 4,115,790 E1017D probably damaging Het
Cttn T C 7: 144,457,724 D116G probably damaging Het
Cyp2c65 A G 19: 39,090,626 probably null Het
Dcaf13 C T 15: 39,118,783 T48I possibly damaging Het
Dsc2 T A 18: 20,038,148 D598V probably damaging Het
Dtx3 G A 10: 127,192,649 T237I probably damaging Het
E130308A19Rik A G 4: 59,719,764 E432G possibly damaging Het
Eps15 G A 4: 109,322,073 V219I probably benign Het
Fam151a A T 4: 106,747,697 I419L possibly damaging Het
Fam89a C T 8: 124,751,697 G38D probably damaging Het
Fdx1l G T 9: 21,073,421 A29E probably benign Het
Gm597 G T 1: 28,777,455 H499N probably benign Het
Hhla1 G A 15: 65,941,781 T234I probably damaging Het
Hspb6 G A 7: 30,554,289 V76M probably damaging Het
Ighmbp2 C A 19: 3,265,325 K698N probably benign Het
Invs A G 4: 48,426,218 I1002V probably damaging Het
Itga8 A C 2: 12,191,769 F612L probably benign Het
Kcnma1 G T 14: 24,003,829 F99L probably benign Het
Klf11 A G 12: 24,655,732 Y395C probably damaging Het
Lama4 G A 10: 39,047,948 E451K probably damaging Het
Lrr1 A G 12: 69,175,110 Y342C probably damaging Het
Lrrc18 A T 14: 33,009,064 M187L probably benign Het
Luc7l3 A G 11: 94,296,930 S311P unknown Het
Lypd3 T A 7: 24,638,924 S133R probably damaging Het
Mcm5 C T 8: 75,117,540 S313F probably benign Het
Mug1 A T 6: 121,880,504 E1062D probably benign Het
Mug1 T A 6: 121,882,740 S1233T probably benign Het
Myh7 T C 14: 54,983,641 K942E probably damaging Het
Nedd9 T C 13: 41,316,465 D404G probably damaging Het
Nisch C A 14: 31,173,668 A1022S probably damaging Het
Nkx3-1 A G 14: 69,191,872 D113G probably benign Het
Olfr1378 T C 11: 50,969,338 F107L probably benign Het
Olfr786 A T 10: 129,437,060 I83F probably damaging Het
Olfr811 A G 10: 129,801,628 F299S probably benign Het
Otub1 C T 19: 7,199,448 G181D probably damaging Het
Palb2 T C 7: 122,127,081 H522R probably benign Het
Pfpl A T 19: 12,430,095 D570V probably damaging Het
Phyhd1 A G 2: 30,281,058 N271S probably damaging Het
Ptprm T C 17: 67,191,296 Q50R probably benign Het
Rfx2 C A 17: 56,780,895 V499L possibly damaging Het
Sema5a C T 15: 32,673,400 Q795* probably null Het
Sf3a2 A G 10: 80,801,475 N49S probably damaging Het
Sft2d1 T G 17: 8,326,980 S156A probably benign Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc25a33 T A 4: 149,752,456 T144S probably benign Het
Slc7a13 A T 4: 19,818,818 K6M possibly damaging Het
Tfap2c G A 2: 172,557,293 D487N probably damaging Het
Thbs1 G A 2: 118,119,416 R624Q probably damaging Het
Thsd4 A G 9: 59,982,743 F857S probably damaging Het
Tnfrsf4 A G 4: 156,016,427 I272V probably benign Het
Trak1 C T 9: 121,391,858 R45C probably benign Het
Trpm2 A G 10: 77,920,486 S1167P probably benign Het
Ttc14 A T 3: 33,801,388 T161S probably benign Het
Ttll1 A G 15: 83,496,378 V262A possibly damaging Het
Ttn C T 2: 76,885,013 E7912K unknown Het
Ufsp1 C A 5: 137,295,283 P165Q possibly damaging Het
Usp19 T G 9: 108,494,695 L390R probably damaging Het
Vegfc G T 8: 54,181,303 C339F probably damaging Het
Vmn2r6 A T 3: 64,556,128 N428K possibly damaging Het
Wdr11 T G 7: 129,608,923 V517G probably damaging Het
Xkr4 T A 1: 3,216,296 D557V probably benign Het
Zan C A 5: 137,380,857 C5327F unknown Het
Zfp770 A T 2: 114,196,468 N373K probably benign Het
Other mutations in Ext1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ext1 APN 15 53344873 missense probably damaging 1.00
IGL02081:Ext1 APN 15 53073446 nonsense probably null
IGL03147:Ext1 UTSW 15 53088072 missense probably damaging 0.98
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0437:Ext1 UTSW 15 53106106 missense probably damaging 1.00
R0881:Ext1 UTSW 15 53344483 missense probably benign 0.23
R1882:Ext1 UTSW 15 53075792 missense probably damaging 1.00
R2135:Ext1 UTSW 15 53101744 missense possibly damaging 0.88
R2175:Ext1 UTSW 15 53068728 missense probably damaging 1.00
R2762:Ext1 UTSW 15 53344927 missense probably benign 0.29
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3752:Ext1 UTSW 15 53075910 missense probably damaging 1.00
R3815:Ext1 UTSW 15 53345089 missense probably benign 0.05
R4096:Ext1 UTSW 15 53073357 missense probably damaging 1.00
R4298:Ext1 UTSW 15 53345125 missense probably benign 0.02
R4362:Ext1 UTSW 15 53107591 intron probably benign
R4550:Ext1 UTSW 15 53101786 missense probably damaging 0.99
R4647:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4648:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4871:Ext1 UTSW 15 53092377 missense probably benign 0.37
R4954:Ext1 UTSW 15 53344492 missense probably damaging 1.00
R5010:Ext1 UTSW 15 53092412 missense probably damaging 1.00
R5153:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5155:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5328:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5385:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5542:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5555:Ext1 UTSW 15 53088143 missense probably damaging 1.00
R5779:Ext1 UTSW 15 53344553 missense probably damaging 0.99
R5874:Ext1 UTSW 15 53101752 missense possibly damaging 0.61
R6401:Ext1 UTSW 15 53106097 missense possibly damaging 0.94
R6604:Ext1 UTSW 15 53083159 missense probably damaging 0.99
R6847:Ext1 UTSW 15 53345154 missense probably benign
R6885:Ext1 UTSW 15 53101692 missense probably damaging 1.00
R7212:Ext1 UTSW 15 53345162 missense probably benign 0.00
R7315:Ext1 UTSW 15 53073387 missense probably damaging 1.00
R7361:Ext1 UTSW 15 53344723 missense probably damaging 1.00
R7474:Ext1 UTSW 15 53344489 missense probably damaging 0.98
R7853:Ext1 UTSW 15 53107485 missense probably damaging 0.96
R7860:Ext1 UTSW 15 53089939 missense possibly damaging 0.84
R8013:Ext1 UTSW 15 53075887 missense possibly damaging 0.78
R8014:Ext1 UTSW 15 53075887 missense possibly damaging 0.78
R8725:Ext1 UTSW 15 53344669 missense possibly damaging 0.91
R8888:Ext1 UTSW 15 53092327 missense probably damaging 1.00
R9162:Ext1 UTSW 15 53345108 nonsense probably null
R9342:Ext1 UTSW 15 53345128 missense probably benign
R9587:Ext1 UTSW 15 53092412 missense possibly damaging 0.53
R9753:Ext1 UTSW 15 53344671 missense probably damaging 1.00
X0021:Ext1 UTSW 15 53345273 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTATCCAGACTCAAGACAAAGAGGC -3'
(R):5'- TGCAGTTTAGGGCATCGAGG -3'

Sequencing Primer
(F):5'- TCAAGACAAAGAGGCACGCC -3'
(R):5'- TTTAGGGCATCGAGGAGCCAC -3'
Posted On 2022-10-06